Regulon of Zur in Ralstonia metallidurans CH34

Properties
Regulator type:	Transcription factor
TF locus tag:	Rmet_0128
Regulator family:	FUR
Regulation mode:
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Ralstonia
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -99 Score: 5.6 Sequence: GAAATGCAACAAGGTTGCATTTA Position: -71 Score: 6.1 Sequence: TGTTTGCAACAATGTTGCATTAA Locus tag: Rmet_1098 Name: yciC2 Funciton: Putative zinc chaperone, COG0523 family
	Rmet_1098	yciC2	Putative zinc chaperone, COG0523 family
Position: -34 Score: 6.1 Sequence: CAGTCGCAACTTTGTTGCATCAA Locus tag: Rmet_0125 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: Rmet_0124 Name: null Funciton: hypothetical transmembrane protein Locus tag: Rmet_0123 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter
	Rmet_0125	yciC	Putative zinc chaperone, COG0523 family
	Rmet_0124		hypothetical transmembrane protein
	Rmet_0123	omr	predicted zinc-related TonB-dependent outer membrane transporter
Position: -26 Score: 6.4 Sequence: TTTTTGCAACATTGTTGCGTTAA Locus tag: Rmet_2621 Name: zip Funciton: Zinc transporter, ZIP family
	Rmet_2621	zip	Zinc transporter, ZIP family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD