Regulon of Zur in Ralstonia pickettii 12J

Properties
Regulator type:	Transcription factor
TF locus tag:	Rpic_3702
Regulator family:	FUR
Regulation mode:
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Ralstonia
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 5.7 Sequence: AATTCGCAACTTAGTTGCATTGG Locus tag: Rpic_0521 Name: null Funciton: hypothetical transmembrane protein Locus tag: Rpic_0522 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter
	Rpic_0521		hypothetical transmembrane protein
	Rpic_0522	omr	predicted zinc-related TonB-dependent outer membrane transporter
Position: -223 Score: 5.9 Sequence: TTGTCGCAACACTGTTGCAGTTG Locus tag: Rpic_2116 Name: tonB Funciton: Component of outer membrane metal uptake system, TonB family Locus tag: Rpic_2117 Name: exbB Funciton: Component of outer membrane metal uptake system, ExbB family Locus tag: Rpic_2118 Name: exbD Funciton: Component of outer membrane metal uptake system, ExbD family
	Rpic_2116	tonB	Component of outer membrane metal uptake system, TonB family
	Rpic_2117	exbB	Component of outer membrane metal uptake system, ExbB family
	Rpic_2118	exbD	Component of outer membrane metal uptake system, ExbD family
Position: -50 Score: 5.2 Sequence: CAATTGCAACTCAATTGCAGCAA Locus tag: Rpic_3702 Name: zur Funciton: Zinc uptake regulator, Fur family Locus tag: Rpic_3703 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	Rpic_3702	zur	Zinc uptake regulator, Fur family
	Rpic_3703	yciC	Putative zinc chaperone, COG0523 family
Position: -48 Score: 6 Sequence: TTCTTGCAACTCTGTTGCGTTTA Locus tag: Rpic_2432 Name: zip Funciton: Zinc transporter, ZIP family
	Rpic_2432	zip	Zinc transporter, ZIP family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD