Regulon of Zur in Cupriavidus taiwanensis

Properties
Regulator type:	Transcription factor
TF locus tag:	RALTA_A0139
Regulator family:	FUR
Regulation mode:
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Ralstonia
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -76 Score: 5.9 Sequence: AATTCGCAACCTTGTTGCAACAG Locus tag: RALTA_A0136 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: RALTA_A0135 Name: null Funciton: hypothetical transmembrane protein Locus tag: RALTA_A0134 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter
	RALTA_A0136	yciC	Putative zinc chaperone, COG0523 family
	RALTA_A0135		hypothetical transmembrane protein
	RALTA_A0134	omr	predicted zinc-related TonB-dependent outer membrane transporter
Position: -35 Score: 6.4 Sequence: TTATTGCAACATTGTTGCGTTTG Locus tag: RALTA_A2241 Name: zip Funciton: Zinc transporter, ZIP family
	RALTA_A2241	zip	Zinc transporter, ZIP family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD