Regulon of Zur in Ralstonia eutropha JMP134

Properties
Regulator type:	Transcription factor
TF locus tag:	Reut_A0164
Regulator family:	FUR
Regulation mode:
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Ralstonia
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6.3 Sequence: CAGTCGCAACTTTGTTGCAATAA Locus tag: Reut_A0161 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: Reut_A0160 Name: null Funciton: hypothetical transmembrane protein Locus tag: Reut_A0159 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter
	Reut_A0161	yciC	Putative zinc chaperone, COG0523 family
	Reut_A0160		hypothetical transmembrane protein
	Reut_A0159	omr	predicted zinc-related TonB-dependent outer membrane transporter
Position: -3 Score: 6.3 Sequence: TTGTTGCAACATTGTTGCGTTTG Locus tag: Reut_A0876 Name: zip Funciton: Zinc transporter, ZIP family
	Reut_A0876	zip	Zinc transporter, ZIP family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD