Regulon of Zur in Ralstonia solanacearum GMI1000

Properties
Regulator type:	Transcription factor
TF locus tag:	RSc0048
Regulator family:	FUR
Regulation mode:
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Ralstonia
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -114 Score: 6.1 Sequence: TATTTGCAACAGAGTTGCAAATT Locus tag: RS00125 Name: omr2 Funciton: predicted zinc-related TonB-dependent outer membrane transporter Locus tag: RS00126 Name: RSc2728 Funciton: hypothetical protein
	RS00125	omr2	predicted zinc-related TonB-dependent outer membrane transporter
	RS00126	RSc2728	hypothetical protein
Position: -95 Score: 5.7 Sequence: AATTCGCAACTTAGTTGCATTGG Locus tag: RS04852 Name: RSc0594 Funciton: hypothetical transmembrane protein Locus tag: RS04851 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter
	RS04852	RSc0594	hypothetical transmembrane protein
	RS04851	omr	predicted zinc-related TonB-dependent outer membrane transporter
Position: -220 Score: 6 Sequence: TTGTCGCAACACTGTTGCATGAA Locus tag: RSc1963 Name: tonB Funciton: Component of outer membrane metal uptake system, TonB family Locus tag: RSc1964 Name: exbB Funciton: Component of outer membrane metal uptake system, ExbB family Locus tag: RSc1965 Name: exbD Funciton: Component of outer membrane metal uptake system, ExbD family
	RSc1963	tonB	Component of outer membrane metal uptake system, TonB family
	RSc1964	exbB	Component of outer membrane metal uptake system, ExbB family
	RSc1965	exbD	Component of outer membrane metal uptake system, ExbD family
Position: -37 Score: 5.9 Sequence: TTCTTGCAACTCTGTTGCGTTTG Locus tag: RS01372 Name: zip Funciton: Zinc transporter, ZIP family
	RS01372	zip	Zinc transporter, ZIP family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD