Regulon of Zur in Ralstonia eutropha H16

Properties
Regulator type:	Transcription factor
TF locus tag:	h16_A0196
Regulator family:	FUR
Regulation mode:
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Ralstonia
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 5.5 Sequence: CAATTGCAATTGAGTTGCGTTAA Locus tag: H16_B2121 Name: h16_B2121 Funciton: hypothetical protein Locus tag: H16_B2120 Name: omr3 Funciton: predicted zinc-related TonB-dependent outer membrane transporter Locus tag: H16_B2119 Name: h16_B2119 Funciton: ABC-type transporter, ATPase component Locus tag: H16_B2118 Name: h16_B2118 Funciton: hypothetical membrane spanning protein Locus tag: H16_B2117 Name: h16_B2117 Funciton: ABC-type transporter, permease component
	H16_B2121	h16_B2121	hypothetical protein
	H16_B2120	omr3	predicted zinc-related TonB-dependent outer membrane transporter
	H16_B2119	h16_B2119	ABC-type transporter, ATPase component
	H16_B2118	h16_B2118	hypothetical membrane spanning protein
	H16_B2117	h16_B2117	ABC-type transporter, permease component
Position: -75 Score: 6 Sequence: AATTCGCAACCTTGTTGCAACAA Locus tag: H16_A0193 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: H16_A0192 Name: h16_A0192 Funciton: hypothetical transmembrane protein Locus tag: H16_A0191 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter
	H16_A0193	yciC	Putative zinc chaperone, COG0523 family
	H16_A0192	h16_A0192	hypothetical transmembrane protein
	H16_A0191	omr	predicted zinc-related TonB-dependent outer membrane transporter
Position: -35 Score: 6.4 Sequence: TTATTGCAACATTGTTGCGTTAG Locus tag: H16_A2738 Name: zip Funciton: Zinc transporter, ZIP family
	H16_A2738	zip	Zinc transporter, ZIP family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD