Regulog YtrA - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Ramoplanin resistance |
| Effector: | Ramoplanin |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - GntR/Others
- By effector - Ramoplanin
- By pathway - Ramoplanin resistance
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 9 | 2 |
| Bacillus amyloliquefaciens FZB42 | 7 | 1 |
| Bacillus pumilus SAFR-032 | 5 | 1 |
| Bacillus licheniformis DSM 13 | 5 | 1 |
| Anoxybacillus flavithermus WK1 | 3 | 1 |
| Geobacillus kaustophilus HTA426 | 3 | 1 |
| Bacillus cereus ATCC 14579 | 4 | 1 |
| Bacillus halodurans C-125 | ||
| Bacillus clausii KSM-K16 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| ytrA |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -244 score = 6.47264 sequence = TGTACTAATTGAAGTAATACA Gene: BSU30460: Transcriptional regulator, GntR family |
*
Bacillus amyloliquefaciens FZB42 Site: position = -238 score = 6.72078 sequence = TGTACTACTTGATGTAATACA Gene: RBAM_027400: Transcriptional regulator, GntR family |
*
Bacillus pumilus SAFR-032 Site: position = -234 score = 6.42666 sequence = TGTACTACATCAACTAATACA Gene: BPUM_2677: Transcriptional regulator, GntR family |
*
Bacillus licheniformis DSM 13 Site: position = -223 score = 6.39037 sequence = TGTACTACATCGAGTAATACA Gene: BLi03185: Transcriptional regulator, GntR family |
*
Anoxybacillus flavithermus WK1 Site: position = -60 score = 6.09431 sequence = CGTATTATTTAATATAATACA Gene: Aflv_1397: Transcriptional regulator, GntR family |
*
Geobacillus kaustophilus HTA426 Site: position = -49 score = 5.85254 sequence = TGTACTATTAGTTATAGTACG Gene: GK1620: Transcriptional regulator, GntR family |
*
Bacillus cereus ATCC 14579 Site: position = -46 score = 6.39889 sequence = TGTATTACATATAGTAGTACA Gene: BC4076: Transcriptional regulator, GntR family |
|
|
|
|
Transcriptional regulator, GntR family |
| ytrB |
Gene: BSU30450: ABC-type multidrug transport system, ATPase component |
Gene: RBAM_027390: ABC-type multidrug transport system, ATPase component |
Gene: BPUM_2676: ABC-type multidrug transport system, ATPase component |
Gene: BLi03184: ABC-type multidrug transport system, ATPase component |
Gene: Aflv_1398: ABC-type multidrug transport system, ATPase component |
Gene: GK1621: ABC-type multidrug transport system, ATPase component |
Gene: BC4077: ABC-type multidrug transport system, ATPase component |
|
|
|
|
ABC-type multidrug transport system, ATPase component |
| ytrC |
2
Bacillus subtilis subsp. subtilis str. 168 Gene: BSU30440: ABC-type multidrug transport system, permease component Gene: BSU30430: ABC-type multidrug transport system, permease component |
3
Bacillus amyloliquefaciens FZB42 Gene: RBAM_027380: ABC-type multidrug transport system, permease component Gene: RBAM_027370: ABC-type multidrug transport system, permease component Gene: RBAM_027360: ABC-type multidrug transport system, permease component |
Gene: BPUM_2675: ABC-type multidrug transport system, permease component |
Gene: BLi03183: ABC-type multidrug transport system, permease component |
Gene: Aflv_1399: ABC-type multidrug transport system, permease component |
Gene: GK1622: ABC-type multidrug transport system, permease component |
2
Bacillus cereus ATCC 14579 Gene: BC4079: ABC-type multidrug transport system, permease component Gene: BC4078: ABC-type multidrug transport system, permease component |
|
|
|
|
ABC-type multidrug transport system, permease component |
| ytrE |
Gene: BSU30420: ABC transporter, ATP-binding protein |
Gene: RBAM_027350: ABC transporter, ATP-binding protein |
Gene: BPUM_2674: ABC transporter, ATP-binding protein |
Gene: BLi03182: ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
ABC transporter, ATP-binding protein |
| ytrF |
Gene: BSU30410: ABC transporter, permease protein |
Gene: RBAM_027340: ABC transporter, permease protein |
Gene: BPUM_2673: ABC transporter, permease protein |
Gene: BLi03181: ABC transporter, permease protein |
|
|
|
|
|
|
|
ABC transporter, permease protein |
| CRON 2. | ||||||||||||
| ywoB |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -34 score = 6.61195 sequence = TGTACTACATCAAATAATACA Gene: BSU36500: Putative integral inner membrane protein |
|
|
|
|
|
|
|
|
|
|
Putative integral inner membrane protein |
| ywoC |
Gene: BSU36490: Nicotinamidase/isochorismatase family protein |
Gene: RBAM_033670: Nicotinamidase/isochorismatase family protein |
|
|
|
|
|
|
|
|
|
Nicotinamidase/isochorismatase family protein |
| ywoD |
Gene: BSU36480: drug resistance transporter, EmrB/QacA family |
Gene: RBAM_033660: drug resistance transporter, EmrB/QacA family |
Gene: BPUM_3295: drug resistance transporter, EmrB/QacA family |
Gene: BLi04075: drug resistance transporter, EmrB/QacA family |
|
|
|
|
|
|
Gene: Pjdr2_3092: drug resistance transporter, EmrB/QacA family |
drug resistance transporter, EmrB/QacA family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |