Regulon of YtrA in Anoxybacillus flavithermus WK1
| Regulator type: | Transcription factor |
| TF locus tag: | Aflv_1397 |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Ramoplanin resistance |
| Effector: | Ramoplanin |
| Regulog: | YtrA - Bacillales |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - GntR/Others
- By effector - Ramoplanin
- By pathway - Ramoplanin resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -60
Score: 6.1 Sequence: CGTATTATTTAATATAATACA
Locus tag: Aflv_1397
Name: ytrA Funciton: Transcriptional regulator, GntR family
Locus tag: Aflv_1398
Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Aflv_1399
Name: ytrC Funciton: ABC-type multidrug transport system, permease component |
|||
|
ytrA
|
Transcriptional regulator, GntR family
|
||
|
ytrB
|
ABC-type multidrug transport system, ATPase component
|
||
|
ytrC
|
ABC-type multidrug transport system, permease component
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |