Regulon of YtrA in Geobacillus kaustophilus HTA426

Properties
Regulator type:	Transcription factor
TF locus tag:	GK1620
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Ramoplanin resistance
Effector:	Ramoplanin
Regulog:	YtrA - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By effector - Ramoplanin
By pathway - Ramoplanin resistance

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.9 Sequence: TGTACTATTAGTTATAGTACG Locus tag: GK1620 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: GK1621 Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component Locus tag: GK1622 Name: ytrC Funciton: ABC-type multidrug transport system, permease component
	GK1620	ytrA	Transcriptional regulator, GntR family
	GK1621	ytrB	ABC-type multidrug transport system, ATPase component
	GK1622	ytrC	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD