Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ytrE gene

Properties
Regulog: YtrA - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Ramoplanin resistance
Effector: Ramoplanin
Phylum: Firmicutes
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus amyloliquefaciens FZB42
Position: -238
Score: 6.72078
Sequence: TGTACTACTTGATGTAATACA
Locus tag: RBAM_027400
Name: ytrA
Funciton: Transcriptional regulator, GntR family
Locus tag: RBAM_027390
Name: ytrB
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: RBAM_027380
Name: ytrC
Funciton: ABC-type multidrug transport system, permease component
Locus tag: RBAM_027370
Name: ytrC
Funciton: ABC-type multidrug transport system, permease component
Locus tag: RBAM_027360
Name: ytrC
Funciton: ABC-type multidrug transport system, permease component
Locus tag: RBAM_027350
Name: ytrE
Funciton: ABC transporter, ATP-binding protein
Locus tag: RBAM_027340
Name: ytrF
Funciton: ABC transporter, permease protein
ytrA-ytrB-ytrC-ytrC-ytrC-ytrE-ytrF -238 6.7 TGTACTACTTGATGTAATACA RBAM_027400
Bacillus licheniformis DSM 13
Position: -223
Score: 6.39037
Sequence: TGTACTACATCGAGTAATACA
Locus tag: BLi03185
Name: ytrA
Funciton: Transcriptional regulator, GntR family
Locus tag: BLi03184
Name: ytrB
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: BLi03183
Name: ytrC
Funciton: ABC-type multidrug transport system, permease component
Locus tag: BLi03182
Name: ytrE
Funciton: ABC transporter, ATP-binding protein
Locus tag: BLi03181
Name: ytrF
Funciton: ABC transporter, permease protein
ytrA-ytrB-ytrC-ytrE-ytrF -223 6.4 TGTACTACATCGAGTAATACA BLi03185
Bacillus pumilus SAFR-032
Position: -234
Score: 6.42666
Sequence: TGTACTACATCAACTAATACA
Locus tag: BPUM_2677
Name: ytrA
Funciton: Transcriptional regulator, GntR family
Locus tag: BPUM_2676
Name: ytrB
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: BPUM_2675
Name: ytrC
Funciton: ABC-type multidrug transport system, permease component
Locus tag: BPUM_2674
Name: ytrE
Funciton: ABC transporter, ATP-binding protein
Locus tag: BPUM_2673
Name: ytrF
Funciton: ABC transporter, permease protein
ytrA-ytrB-ytrC-ytrE-ytrF -234 6.4 TGTACTACATCAACTAATACA BPUM_2677
Bacillus subtilis subsp. subtilis str. 168
Position: -244
Score: 6.47264
Sequence: TGTACTAATTGAAGTAATACA
Locus tag: BSU30460
Name: ytrA
Funciton: Transcriptional regulator, GntR family
Locus tag: BSU30450
Name: ytrB
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: BSU30440
Name: ytrC
Funciton: ABC-type multidrug transport system, permease component
Locus tag: BSU30430
Name: ytrC
Funciton: ABC-type multidrug transport system, permease component
Locus tag: BSU30420
Name: ytrE
Funciton: ABC transporter, ATP-binding protein
Locus tag: BSU30410
Name: ytrF
Funciton: ABC transporter, permease protein
ytrA-ytrB-ytrC-ytrC-ytrE-ytrF -244 6.5 TGTACTAATTGAAGTAATACA BSU30460