Regulon of YtrA in Bacillus licheniformis DSM 13

Properties
Regulator type:	Transcription factor
TF locus tag:	BLi03185
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Ramoplanin resistance
Effector:	Ramoplanin
Regulog:	YtrA - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By effector - Ramoplanin
By pathway - Ramoplanin resistance

Regulated operons
	Locus Tag	Name	Function
Position: -223 Score: 6.4 Sequence: TGTACTACATCGAGTAATACA Locus tag: BLi03185 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: BLi03184 Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component Locus tag: BLi03183 Name: ytrC Funciton: ABC-type multidrug transport system, permease component Locus tag: BLi03182 Name: ytrE Funciton: ABC transporter, ATP-binding protein Locus tag: BLi03181 Name: ytrF Funciton: ABC transporter, permease protein
	BLi03185	ytrA	Transcriptional regulator, GntR family
	BLi03184	ytrB	ABC-type multidrug transport system, ATPase component
	BLi03183	ytrC	ABC-type multidrug transport system, permease component
	BLi03182	ytrE	ABC transporter, ATP-binding protein
	BLi03181	ytrF	ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD