Regulon of YtrA in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type:	Transcription factor
TF locus tag:	BSU30460
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Ramoplanin resistance
Effector:	Ramoplanin
Regulog:	YtrA - Bacillales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By effector - Ramoplanin
By pathway - Ramoplanin resistance

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 6.6 Sequence: TGTACTACATCAAATAATACA Locus tag: BSU36500 Name: ywoB Funciton: Putative integral inner membrane protein Locus tag: BSU36490 Name: ywoC Funciton: Nicotinamidase/isochorismatase family protein Locus tag: BSU36480 Name: ywoD Funciton: drug resistance transporter, EmrB/QacA family
	BSU36500	ywoB	Putative integral inner membrane protein
	BSU36490	ywoC	Nicotinamidase/isochorismatase family protein
	BSU36480	ywoD	drug resistance transporter, EmrB/QacA family
Position: -244 Score: 6.5 Sequence: TGTACTAATTGAAGTAATACA Locus tag: BSU30460 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: BSU30450 Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component Locus tag: BSU30440 Name: ytrC Funciton: ABC-type multidrug transport system, permease component Locus tag: BSU30430 Name: ytrC Funciton: ABC-type multidrug transport system, permease component Locus tag: BSU30420 Name: ytrE Funciton: ABC transporter, ATP-binding protein Locus tag: BSU30410 Name: ytrF Funciton: ABC transporter, permease protein
	BSU30460	ytrA	Transcriptional regulator, GntR family
	BSU30450	ytrB	ABC-type multidrug transport system, ATPase component
	BSU30440	ytrC	ABC-type multidrug transport system, permease component
	BSU30430	ytrC	ABC-type multidrug transport system, permease component
	BSU30420	ytrE	ABC transporter, ATP-binding protein
	BSU30410	ytrF	ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD