Orthologous regulated operons containing ytrC gene

Properties
Regulog:	YtrA - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Ramoplanin resistance
Effector:	Ramoplanin
Phylum:	Firmicutes

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Anoxybacillus flavithermus WK1
Position: -60 Score: 6.09431 Sequence: CGTATTATTTAATATAATACA Locus tag: Aflv_1397 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: Aflv_1398 Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Aflv_1399 Name: ytrC Funciton: ABC-type multidrug transport system, permease component
ytrA-ytrB-ytrC	-60	6.1	CGTATTATTTAATATAATACA	Aflv_1397
Bacillus amyloliquefaciens FZB42
Position: -238 Score: 6.72078 Sequence: TGTACTACTTGATGTAATACA Locus tag: RBAM_027400 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: RBAM_027390 Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component Locus tag: RBAM_027380 Name: ytrC Funciton: ABC-type multidrug transport system, permease component Locus tag: RBAM_027370 Name: ytrC Funciton: ABC-type multidrug transport system, permease component Locus tag: RBAM_027360 Name: ytrC Funciton: ABC-type multidrug transport system, permease component Locus tag: RBAM_027350 Name: ytrE Funciton: ABC transporter, ATP-binding protein Locus tag: RBAM_027340 Name: ytrF Funciton: ABC transporter, permease protein
ytrA-ytrB-ytrC-ytrC-ytrC-ytrE-ytrF	-238	6.7	TGTACTACTTGATGTAATACA	RBAM_027400
Bacillus cereus ATCC 14579
Position: -46 Score: 6.39889 Sequence: TGTATTACATATAGTAGTACA Locus tag: BC4076 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: BC4077 Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component Locus tag: BC4078 Name: ytrC Funciton: ABC-type multidrug transport system, permease component Locus tag: BC4079 Name: ytrC Funciton: ABC-type multidrug transport system, permease component
ytrA-ytrB-ytrC-ytrC	-46	6.4	TGTATTACATATAGTAGTACA	BC4076
Bacillus licheniformis DSM 13
Position: -223 Score: 6.39037 Sequence: TGTACTACATCGAGTAATACA Locus tag: BLi03185 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: BLi03184 Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component Locus tag: BLi03183 Name: ytrC Funciton: ABC-type multidrug transport system, permease component Locus tag: BLi03182 Name: ytrE Funciton: ABC transporter, ATP-binding protein Locus tag: BLi03181 Name: ytrF Funciton: ABC transporter, permease protein
ytrA-ytrB-ytrC-ytrE-ytrF	-223	6.4	TGTACTACATCGAGTAATACA	BLi03185
Bacillus pumilus SAFR-032
Position: -234 Score: 6.42666 Sequence: TGTACTACATCAACTAATACA Locus tag: BPUM_2677 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: BPUM_2676 Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component Locus tag: BPUM_2675 Name: ytrC Funciton: ABC-type multidrug transport system, permease component Locus tag: BPUM_2674 Name: ytrE Funciton: ABC transporter, ATP-binding protein Locus tag: BPUM_2673 Name: ytrF Funciton: ABC transporter, permease protein
ytrA-ytrB-ytrC-ytrE-ytrF	-234	6.4	TGTACTACATCAACTAATACA	BPUM_2677
Bacillus subtilis subsp. subtilis str. 168
Position: -244 Score: 6.47264 Sequence: TGTACTAATTGAAGTAATACA Locus tag: BSU30460 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: BSU30450 Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component Locus tag: BSU30440 Name: ytrC Funciton: ABC-type multidrug transport system, permease component Locus tag: BSU30430 Name: ytrC Funciton: ABC-type multidrug transport system, permease component Locus tag: BSU30420 Name: ytrE Funciton: ABC transporter, ATP-binding protein Locus tag: BSU30410 Name: ytrF Funciton: ABC transporter, permease protein
ytrA-ytrB-ytrC-ytrC-ytrE-ytrF	-244	6.5	TGTACTAATTGAAGTAATACA	BSU30460
Geobacillus kaustophilus HTA426
Position: -49 Score: 5.85254 Sequence: TGTACTATTAGTTATAGTACG Locus tag: GK1620 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: GK1621 Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component Locus tag: GK1622 Name: ytrC Funciton: ABC-type multidrug transport system, permease component
ytrA-ytrB-ytrC	-49	5.9	TGTACTATTAGTTATAGTACG	GK1620

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing ytrC gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --