Regulog Rex - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | Rex |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | NADH |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By trascription factor - Rex
- By TF family - Rex
- By effector - NADH
- By pathway - Energy metabolism
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 10 | 5 |
| Bacillus amyloliquefaciens FZB42 | 8 | 4 |
| Bacillus pumilus SAFR-032 | 9 | 3 |
| Bacillus licheniformis DSM 13 | 12 | 7 |
| Anoxybacillus flavithermus WK1 | 10 | 6 |
| Geobacillus kaustophilus HTA426 | 3 | 3 |
| Bacillus cereus ATCC 14579 | 9 | 5 |
| Bacillus halodurans C-125 | 2 | 1 |
| Bacillus clausii KSM-K16 | 3 | 3 |
| Oceanobacillus iheyensis HTE831 | 8 | 4 |
| Paenibacillus sp. JDR-2 | 7 | 4 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| ndh2 |
Gene: BSU32100: NADH dehydrogenase (EC 1.6.99.3) |
Gene: RBAM_029150: NADH dehydrogenase (EC 1.6.99.3) |
Gene: BPUM_2872: NADH dehydrogenase (EC 1.6.99.3) |
*
Bacillus licheniformis DSM 13 Site: position = -119 score = 4.91014 sequence = AAAGTGAAGGGTTTCACAAA Gene: BLi03392: NADH dehydrogenase (EC 1.6.99.3) |
*
Anoxybacillus flavithermus WK1 Site: position = -76 score = 5.48963 sequence = TTCGTGAATAAATTCACAAA Gene: Aflv_2402: NADH dehydrogenase (EC 1.6.99.3) |
*
Geobacillus kaustophilus HTA426 Site: position = -102 score = 5.55038 sequence = AACGTGAATTATTTCACAAA Gene: GK2953: NADH dehydrogenase (EC 1.6.99.3) |
Gene: BC4925: NADH dehydrogenase (EC 1.6.99.3) |
Gene: BH3407: NADH dehydrogenase (EC 1.6.99.3) |
*
Bacillus clausii KSM-K16 Site: position = -55 score = 4.76869 sequence = AAAGTGAAATGAATCACAAA Gene: ABC2924: NADH dehydrogenase (EC 1.6.99.3) |
Gene: OB2350: NADH dehydrogenase (EC 1.6.99.3) |
*
Paenibacillus sp. JDR-2 Site: position = -64 score = 5.72113 sequence = ATTGTGTAATTTTTCACAAA Gene: Pjdr2_4834: NADH dehydrogenase (EC 1.6.99.3) |
NADH dehydrogenase (EC 1.6.99.3) |
| CRON 2. | ||||||||||||
| yndG |
Gene: BSU17780: Hypothetical protein |
Gene: RBAM_018020: Hypothetical protein |
*
Bacillus pumilus SAFR-032 Site: position = -35 score = 5.51794 sequence = TATGTGAAACAATTCACATA Gene: BPUM_1837: Hypothetical protein |
*
Bacillus licheniformis DSM 13 Site: position = -32 score = 5.82995 sequence = ATTGTGAATATATTCACAAA Gene: BLi02193: Hypothetical protein |
|
|
*
Bacillus cereus ATCC 14579 Site: position = -71 score = 4.99187 sequence = TTTGTGAAAAATGTAGCAAA Gene: BC1749: Hypothetical protein |
|
|
Gene: OB0728: Hypothetical protein |
|
Hypothetical protein |
| yndH |
Gene: BSU17790: Hypothetical protein |
Gene: RBAM_018030: Hypothetical protein |
Gene: BPUM_1836: Hypothetical protein |
Gene: BLi02192: Hypothetical protein |
|
|
Gene: BC1750: Hypothetical protein |
|
|
Gene: OB0729: Hypothetical protein |
Gene: Pjdr2_2731: Hypothetical protein |
Hypothetical protein |
| yndJ |
Gene: BSU17800: Putative integral inner membrane protein |
Gene: RBAM_018040: Putative integral inner membrane protein |
Gene: BPUM_1835: Putative integral inner membrane protein |
Gene: BLi02191: Putative integral inner membrane protein |
|
|
Gene: BC1751: Putative integral inner membrane protein |
|
|
Gene: OB0730: Putative integral inner membrane protein |
|
Putative integral inner membrane protein |
| CRON 3. | ||||||||||||
| yjlC |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -113 score = 5.95929 sequence = ATTGTGCATGAATTCACAAT Gene: BSU12280: Hypothetical protein |
*
Bacillus amyloliquefaciens FZB42 Site: position = -110 score = 5.95929 sequence = ATTGTGCATGAATTCACAAT Gene: RBAM_012360: Hypothetical protein |
|
*
Bacillus licheniformis DSM 13 Site: position = -80 score = 6.00858 sequence = TTTGTGCATAAATTCACAAA Gene: BLi02135: Hypothetical protein |
|
|
*
Bacillus cereus ATCC 14579 Site: position = -82 score = 4.79697 sequence = TTTGTGAAACTTTGTATAAA Gene: BC5060: Hypothetical protein |
|
|
|
*
Paenibacillus sp. JDR-2 Site: position = -97 score = 5.42153 sequence = ATTGTGAATAATTTCACTTT Gene: Pjdr2_6270: Hypothetical protein |
Hypothetical protein |
| ndh |
Gene: BSU12290: NADH dehydrogenase (EC 1.6.99.3) |
Gene: RBAM_012370: NADH dehydrogenase (EC 1.6.99.3) |
|
Gene: BLi02134: NADH dehydrogenase (EC 1.6.99.3) |
|
|
Gene: BC5061: NADH dehydrogenase (EC 1.6.99.3) |
|
|
|
Gene: Pjdr2_6269: NADH dehydrogenase (EC 1.6.99.3) |
NADH dehydrogenase (EC 1.6.99.3) |
| CRON 4. | ||||||||||||
| ydbI |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -68 score = 5.08404 sequence = TTTGTTATATAATTTACAAA Gene: BSU04480: Putative integral inner membrane protein |
*
Bacillus amyloliquefaciens FZB42 Site: position = -73 score = 5.1022 sequence = TTTGTTATATAATTTACAAT Gene: RBAM_004810: Putative integral inner membrane protein |
Gene: BPUM_0420: Putative integral inner membrane protein |
Gene: BLi00535: Putative integral inner membrane protein |
|
|
|
|
|
|
|
Putative integral inner membrane protein |
| CRON 5. | ||||||||||||
| qoxA |
Gene: BSU38170: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-) |
Gene: RBAM_035430: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-) |
Gene: BPUM_3464: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-) |
Gene: BLi04040: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-) |
*
Anoxybacillus flavithermus WK1 Site: position = -36 score = 5.16939 sequence = TTTGTTCAATGAATCACAAT Gene: Aflv_0272: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-) |
Gene: GK3459: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-) |
Gene: BC0698: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-) |
Gene: BH2064: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-) |
Gene: ABC2137: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-) |
*
Oceanobacillus iheyensis HTE831 Site: position = -123 score = 5.43368 sequence = TTTGTGAAGCATTTCTCAAA Gene: OB2253: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-) |
|
Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-) |
| qoxB |
Gene: BSU38160: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-) |
Gene: RBAM_035420: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-) |
Gene: BPUM_3463: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-) |
Gene: BLi04039: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-) |
Gene: Aflv_0273: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-) |
Gene: GK3458: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-) |
Gene: BC0697: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-) |
Gene: BH2065: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-) |
Gene: ABC2136: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-) |
Gene: OB2254: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-) |
|
Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-) |
| qoxC |
Gene: BSU38150: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-) |
Gene: RBAM_035410: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-) |
Gene: BPUM_3462: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-) |
Gene: BLi04038: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-) |
Gene: Aflv_0274: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-) |
Gene: GK3457: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-) |
Gene: BC0696: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-) |
Gene: BH2066: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-) |
Gene: ABC2135: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-) |
Gene: OB2255: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-) |
|
Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-) |
| qoxD |
Gene: BSU38140: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-) |
Gene: RBAM_035400: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-) |
Gene: BPUM_3461: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-) |
Gene: BLi04037: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-) |
Gene: Aflv_0275: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-) |
Gene: GK3456: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-) |
Gene: BC0695: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-) |
Gene: BH2067: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-) |
Gene: ABC2134: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-) |
Gene: OB2256: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-) |
|
Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-) |
| CRON 6. | ||||||||||||
| pflB |
|
|
|
*
Bacillus licheniformis DSM 13 Site: position = -119 score = 5.96302 sequence = TTTGTTAACTATTTCACAAA Gene: BLi02132: Pyruvate formate-lyase (EC 2.3.1.54) |
*
Anoxybacillus flavithermus WK1 Site: position = -117 score = 4.96646 sequence = TTTGATCAACTTTTCACAAA Gene: Aflv_2793: Pyruvate formate-lyase (EC 2.3.1.54) |
|
*
Bacillus cereus ATCC 14579 Site: position = -129 score = 5.47832 sequence = TTTGCTCAACATTTCACAAA Gene: BC0491: Pyruvate formate-lyase (EC 2.3.1.54) |
|
|
|
|
Pyruvate formate-lyase (EC 2.3.1.54) |
| pflA |
|
|
|
Gene: BLi02131: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
Gene: Aflv_2794: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
|
Gene: BC0492: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
|
|
|
Gene: Pjdr2_5251: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
| CRON 7. | ||||||||||||
| nirS |
|
|
|
|
|
*
Geobacillus kaustophilus HTA426 Site: position = -122 score = 5.73305 sequence = ATTGCTCATTATTTCACAAA Gene: GK0767: Copper-containing nitrite reductase (EC 1.7.2.1) |
|
|
|
|
|
Copper-containing nitrite reductase (EC 1.7.2.1) |
| CRON 8. | ||||||||||||
| ldh |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -62 score = 6.0433 sequence = AATGTGAAATACTTCACAAA Site: position = -85 score = 5.96092 sequence = TTTGTGAAGTGTTGCACAAT Gene: BSU03050: L-lactate dehydrogenase (EC 1.1.1.27) |
*
Bacillus amyloliquefaciens FZB42 Site: position = -59 score = 5.56352 sequence = AATGTGAAATACTTCACAAG Site: position = -82 score = 6.26873 sequence = TTTGTGAAGTATTGCACAAT Gene: RBAM_003290: L-lactate dehydrogenase (EC 1.1.1.27) |
*
Bacillus pumilus SAFR-032 Site: position = -56 score = 5.74408 sequence = AATGTGAAATACTTCACATA Site: position = -79 score = 6.26873 sequence = TTTGTGAAGTATTGCACAAT Gene: BPUM_0277: L-lactate dehydrogenase (EC 1.1.1.27) |
*
Bacillus licheniformis DSM 13 Site: position = -59 score = 5.77272 sequence = AATGTGAAGAATTTCACAAA Site: position = -82 score = 5.9695 sequence = TATGTGAAGTATTGCACAAT Gene: BLi00366: L-lactate dehydrogenase (EC 1.1.1.27) |
*
Anoxybacillus flavithermus WK1 Site: position = -58 score = 5.44466 sequence = TTTGTGAAACAGTGTACAAT Gene: Aflv_0889: L-lactate dehydrogenase (EC 1.1.1.27) |
*
Geobacillus kaustophilus HTA426 Site: position = -42 score = 5.53073 sequence = AATGTGAATATATTCACAAA Gene: GK0475: L-lactate dehydrogenase (EC 1.1.1.27) |
|
*
Bacillus halodurans C-125 Site: position = -44 score = 5.10401 sequence = CATGTGAAAATATTCACAAA Site: position = -219 score = 5.71641 sequence = CATGTGAAATATTTCACAAA Site: position = -276 score = 6.21435 sequence = AATGTGAAATATTTCACAAA Gene: BH3937: L-lactate dehydrogenase (EC 1.1.1.27) |
*
Bacillus clausii KSM-K16 Site: position = -45 score = 5.87254 sequence = AATGTGAATAATTTCACAAA Site: position = -68 score = 6.36855 sequence = TTTGTGAAATAATGCACAAT Gene: ABC2872: L-lactate dehydrogenase (EC 1.1.1.27) |
*
Oceanobacillus iheyensis HTE831 Site: position = -68 score = 6.51357 sequence = TTTGTGAAATATTTCACAAT Gene: OB3279: L-lactate dehydrogenase (EC 1.1.1.27) |
|
L-lactate dehydrogenase (EC 1.1.1.27) |
| lctP |
Gene: BSU03060: L-lactate permease |
|
Gene: BPUM_0278: L-lactate permease |
Gene: BLi00367: L-lactate permease |
|
|
|
Gene: BH3936: L-lactate permease |
|
|
|
L-lactate permease |
| CRON 9. | ||||||||||||
| cydA |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -53 score = 5.37656 sequence = TTTGTGAAGTAGTGAGCAAA Site: position = -85 score = 5.30258 sequence = TTTGTGAATTACTGATCAAA Site: position = -120 score = 5.80428 sequence = TTTGTGAAATATTGAGCAAT Gene: BSU38760: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) |
*
Bacillus amyloliquefaciens FZB42 Site: position = -44 score = 5.49647 sequence = TTTGTGAAATGTTGAGCAAT Site: position = -76 score = 5.03577 sequence = TTTGTGAAATACCGAGCAAT Site: position = -106 score = 5.47832 sequence = TTTGTGAAACATTGAGCAAA Gene: RBAM_036010: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) |
*
Bacillus pumilus SAFR-032 Site: position = -68 score = 4.76953 sequence = TTTGTGAAGTGGTGAGCATA Site: position = -98 score = 5.58141 sequence = TTTGTGAACCATTGAACAAA Gene: BPUM_3519: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) |
Gene: BLi04134: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) |
|
|
Gene: BC1938: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) |
|
|
|
|
Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) |
| cydB |
Gene: BSU38750: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) |
Gene: RBAM_036000: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) |
Gene: BPUM_3518: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) |
Gene: BLi04133: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) |
|
|
Gene: BC1939: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) |
|
|
|
|
Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) |
| cydC |
Gene: BSU38740: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
Gene: RBAM_035990: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
Gene: BPUM_3517: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
Gene: BLi04132: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
|
|
Gene: BC1940: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
Gene: BH3971: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
|
Gene: OB1047: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
|
ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
| cydD |
Gene: BSU38730: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
Gene: RBAM_035980: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
Gene: BPUM_3516: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
Gene: BLi04131: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
|
|
Gene: BC1941: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
Gene: BH3972: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
|
Gene: OB1048: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
|
ABC membrane transporter (ATP-binding protein) required for cytochrome bd function |
| CRON 10. | ||||||||||||
| coxA |
|
|
|
|
Gene: Aflv_1360: Cytochrome c oxidase (B(O/a)3-type) chain II (EC 1.9.3.1) |
Gene: GK1547: Cytochrome c oxidase (B(O/a)3-type) chain II (EC 1.9.3.1) |
|
Gene: BH0740: Cytochrome c oxidase (B(O/a)3-type) chain II (EC 1.9.3.1) |
|
*
Oceanobacillus iheyensis HTE831 Site: position = -254 score = 5.71212 sequence = TTTGTGCATAATTGAACAAA Gene: OB1745: Cytochrome c oxidase (B(O/a)3-type) chain II (EC 1.9.3.1) |
|
Cytochrome c oxidase (B(O/a)3-type) chain II (EC 1.9.3.1) |
| coxB |
|
|
|
|
Gene: Aflv_1359: Cytochrome c oxidase (B(O/a)3-type) chain I (EC 1.9.3.1) |
Gene: GK1546: Cytochrome c oxidase (B(O/a)3-type) chain I (EC 1.9.3.1) |
|
Gene: BH0739: Cytochrome c oxidase (B(O/a)3-type) chain I (EC 1.9.3.1) |
|
Gene: OB1746: Cytochrome c oxidase (B(O/a)3-type) chain I (EC 1.9.3.1) |
|
Cytochrome c oxidase (B(O/a)3-type) chain I (EC 1.9.3.1) |
| CRON 11. | ||||||||||||
| adhB |
|
Gene: RBAM_017440: Alcohol dehydrogenase (EC 1.1.1.1), Zn-dependent |
|
|
|
|
*
Bacillus cereus ATCC 14579 Site: position = -163 score = 5.80408 sequence = ATTGTTCATAATTTCACAAA Gene: BC2220: Alcohol dehydrogenase (EC 1.1.1.1), Zn-dependent |
|
|
|
|
Alcohol dehydrogenase (EC 1.1.1.1), Zn-dependent |
| CRON 12. | ||||||||||||
| adhE |
|
|
|
*
Bacillus licheniformis DSM 13 Site: position = -92 score = 5.70783 sequence = CTTGTGAAATGTTTCACAAA Site: position = -216 score = 5.81993 sequence = TTTGTTCAACATTTCACAAA Gene: BLi04290: Alcohol dehydrogenase (EC 1.1.1.1), Fe-dependent; Acetaldehyde dehydrogenase (EC 1.2.1.10) |
*
Anoxybacillus flavithermus WK1 Site: position = -97 score = 5.47832 sequence = TTTGCTCAATGTTTCACAAA Site: position = -445 score = 6.14589 sequence = TTTGTTCAATATTTCACAAT Gene: Aflv_2814: Alcohol dehydrogenase (EC 1.1.1.1), Fe-dependent; Acetaldehyde dehydrogenase (EC 1.2.1.10) |
|
|
|
|
|
|
Alcohol dehydrogenase (EC 1.1.1.1), Fe-dependent; Acetaldehyde dehydrogenase (EC 1.2.1.10) |
| CRON 13. | ||||||||||||
| noxE |
|
|
|
|
|
|
|
|
*
Bacillus clausii KSM-K16 Site: position = -41 score = 4.79529 sequence = CTTGTGAAATTACTCACATT Site: position = -72 score = 5.2398 sequence = TTTGCTCAATGGTTCACAAA Site: position = -114 score = 5.01945 sequence = TTTGCTCACCAGTTCACAAT Gene: ABC1842: NADH oxidase (EC 1.6.99.3) |
*
Oceanobacillus iheyensis HTE831 Site: position = -44 score = 5.66704 sequence = ATTGTGAAATGCTGAACAAA Site: position = -111 score = 5.72241 sequence = ATTGTGAAAAACTGAACAAT Gene: OB3312: NADH oxidase (EC 1.6.99.3) |
*
Paenibacillus sp. JDR-2 Site: position = -42 score = 4.79688 sequence = TATGTGAATAATTTCACAGG Site: position = -207 score = 5.79341 sequence = ATTGTGAATTAATTCACACA Site: position = -273 score = 4.77713 sequence = TATGTGAAATTAATCACAAC Gene: Pjdr2_2160: NADH oxidase (EC 1.6.99.3) |
NADH oxidase (EC 1.6.99.3) |
| CRON 14. | ||||||||||||
| nadA |
Gene: BSU27850: Quinolinate synthetase (EC 4.1.99.-) |
Gene: RBAM_024900: Quinolinate synthetase (EC 4.1.99.-) |
Gene: BPUM_2425: Quinolinate synthetase (EC 4.1.99.-) |
Gene: BLi02912: Quinolinate synthetase (EC 4.1.99.-) |
Gene: Aflv_0705: Quinolinate synthetase (EC 4.1.99.-) |
Gene: GK2599: Quinolinate synthetase (EC 4.1.99.-) |
Gene: BC4421: Quinolinate synthetase (EC 4.1.99.-) |
Gene: BH1220: Quinolinate synthetase (EC 4.1.99.-) |
Gene: ABC1549: Quinolinate synthetase (EC 4.1.99.-) |
|
*
Paenibacillus sp. JDR-2 Site: position = -84 score = 5.97136 sequence = TTTGTGCATCAATTCACAAA Gene: Pjdr2_0068: Quinolinate synthetase (EC 4.1.99.-) |
Quinolinate synthetase (EC 4.1.99.-) |
| nadB |
Gene: BSU27870: L-aspartate oxidase (EC 1.4.3.16) |
Gene: RBAM_024920: L-aspartate oxidase (EC 1.4.3.16) |
Gene: BPUM_2427: L-aspartate oxidase (EC 1.4.3.16) |
Gene: BLi02914: L-aspartate oxidase (EC 1.4.3.16) |
Gene: Aflv_0703: L-aspartate oxidase (EC 1.4.3.16) |
Gene: GK2601: L-aspartate oxidase (EC 1.4.3.16) |
Gene: BC4423: L-aspartate oxidase (EC 1.4.3.16) |
Gene: BH1218: L-aspartate oxidase (EC 1.4.3.16) |
Gene: ABC1547: L-aspartate oxidase (EC 1.4.3.16) |
|
Gene: Pjdr2_0069: L-aspartate oxidase (EC 1.4.3.16) |
L-aspartate oxidase (EC 1.4.3.16) |
| nadC |
Gene: BSU27860: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: RBAM_024910: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: BPUM_2426: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: BLi02913: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: Aflv_0704: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: GK2600: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: BC4422: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: BH1219: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: ABC1548: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
|
Gene: Pjdr2_0070: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
| CRON 15. | ||||||||||||
| ywcJ |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -66 score = 6.36068 sequence = ATTGTGAAATACTTCACAAT Gene: BSU38060: Formate/nitrite family of transporters |
|
|
*
Bacillus licheniformis DSM 13 Site: position = -89 score = 6.20577 sequence = TTTGTGAAATGTTTCACAAT Gene: BLi04135: Formate/nitrite family of transporters |
*
Anoxybacillus flavithermus WK1 Site: position = -43 score = 4.89676 sequence = AGTGTGAAAAACATCACAAA Gene: Aflv_1436: Nitrite transporter |
|
*
Bacillus cereus ATCC 14579 Site: position = -103 score = 6.11381 sequence = TTTGTGAAACATTGCACAAA Gene: BC1308: Formate/nitrite family of transporters |
|
|
|
|
Formate/nitrite family of transporters |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |