Regulon of Rex in Bacillus amyloliquefaciens FZB42

Properties
Regulator type:	Transcription factor
TF locus tag:	RBAM_006420
Regulator family:	Rex
Regulation mode:	repressor
Biological process:	Energy metabolism
Effector:	NADH
Regulog:	Rex - Bacillales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 64 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - Rex
By TF family - Rex
By effector - NADH
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -110 Score: 6 Sequence: ATTGTGCATGAATTCACAAT Locus tag: RBAM_012360 Name: yjlC Funciton: Hypothetical protein Locus tag: RBAM_012370 Name: ndh Funciton: NADH dehydrogenase (EC 1.6.99.3)
	RBAM_012360	yjlC	Hypothetical protein
	RBAM_012370	ndh	NADH dehydrogenase (EC 1.6.99.3)
Position: -73 Score: 5.1 Sequence: TTTGTTATATAATTTACAAT Locus tag: RBAM_004810 Name: ydbI Funciton: Putative integral inner membrane protein
	RBAM_004810	ydbI	Putative integral inner membrane protein
Position: -82 Score: 6.3 Sequence: TTTGTGAAGTATTGCACAAT Position: -59 Score: 5.6 Sequence: AATGTGAAATACTTCACAAG Locus tag: RBAM_003290 Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
	RBAM_003290	ldh	L-lactate dehydrogenase (EC 1.1.1.27)
Position: -106 Score: 5.5 Sequence: TTTGTGAAACATTGAGCAAA Position: -76 Score: 5 Sequence: TTTGTGAAATACCGAGCAAT Position: -44 Score: 5.5 Sequence: TTTGTGAAATGTTGAGCAAT Locus tag: RBAM_036010 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: RBAM_036000 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) Locus tag: RBAM_035990 Name: cydC Funciton: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function Locus tag: RBAM_035980 Name: cydD Funciton: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
	RBAM_036010	cydA	Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
	RBAM_036000	cydB	Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
	RBAM_035990	cydC	ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
	RBAM_035980	cydD	ABC membrane transporter (ATP-binding protein) required for cytochrome bd function

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD