Regulon of Rex in Oceanobacillus iheyensis HTE831

Properties
Regulator type:	Transcription factor
TF locus tag:	OB0652
Regulator family:	Rex
Regulation mode:	repressor
Biological process:	Energy metabolism
Effector:	NADH
Regulog:	Rex - Bacillales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 64 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - Rex
By TF family - Rex
By effector - NADH
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -123 Score: 5.4 Sequence: TTTGTGAAGCATTTCTCAAA Locus tag: OB2253 Name: qoxA Funciton: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-) Locus tag: OB2254 Name: qoxB Funciton: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-) Locus tag: OB2255 Name: qoxC Funciton: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-) Locus tag: OB2256 Name: qoxD Funciton: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
	OB2253	qoxA	Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-)
	OB2254	qoxB	Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-)
	OB2255	qoxC	Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-)
	OB2256	qoxD	Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
Position: -68 Score: 6.5 Sequence: TTTGTGAAATATTTCACAAT Locus tag: OB3279 Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.1.27)
	OB3279	ldh	L-lactate dehydrogenase (EC 1.1.1.27)
Position: -254 Score: 5.7 Sequence: TTTGTGCATAATTGAACAAA Locus tag: OB1745 Name: coxA Funciton: Cytochrome c oxidase (B(O/a)3-type) chain II (EC 1.9.3.1) Locus tag: OB1746 Name: coxB Funciton: Cytochrome c oxidase (B(O/a)3-type) chain I (EC 1.9.3.1)
	OB1745	coxA	Cytochrome c oxidase (B(O/a)3-type) chain II (EC 1.9.3.1)
	OB1746	coxB	Cytochrome c oxidase (B(O/a)3-type) chain I (EC 1.9.3.1)
Position: -111 Score: 5.7 Sequence: ATTGTGAAAAACTGAACAAT Position: -44 Score: 5.7 Sequence: ATTGTGAAATGCTGAACAAA Locus tag: OB3312 Name: noxE Funciton: NADH oxidase (EC 1.6.99.3)
	OB3312	noxE	NADH oxidase (EC 1.6.99.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD