Regulon of Rex in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type:	Transcription factor
TF locus tag:	BSU05970
Regulator family:	Rex
Regulation mode:	repressor
Biological process:	Energy metabolism
Effector:	NADH
Regulog:	Rex - Bacillales
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 64 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - Rex
By TF family - Rex
By effector - NADH
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6.4 Sequence: ATTGTGAAATACTTCACAAT Locus tag: BSU38060 Name: ywcJ Funciton: Formate/nitrite family of transporters
	BSU38060	ywcJ	Formate/nitrite family of transporters
Position: -113 Score: 6 Sequence: ATTGTGCATGAATTCACAAT Locus tag: BSU12280 Name: yjlC Funciton: Hypothetical protein Locus tag: BSU12290 Name: ndh Funciton: NADH dehydrogenase (EC 1.6.99.3)
	BSU12280	yjlC	Hypothetical protein
	BSU12290	ndh	NADH dehydrogenase (EC 1.6.99.3)
Position: -68 Score: 5.1 Sequence: TTTGTTATATAATTTACAAA Locus tag: BSU04480 Name: ydbI Funciton: Putative integral inner membrane protein
	BSU04480	ydbI	Putative integral inner membrane protein
Position: -85 Score: 6 Sequence: TTTGTGAAGTGTTGCACAAT Position: -62 Score: 6 Sequence: AATGTGAAATACTTCACAAA Locus tag: BSU03050 Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.1.27) Locus tag: BSU03060 Name: lctP Funciton: L-lactate permease
	BSU03050	ldh	L-lactate dehydrogenase (EC 1.1.1.27)
	BSU03060	lctP	L-lactate permease
Position: -120 Score: 5.8 Sequence: TTTGTGAAATATTGAGCAAT Position: -85 Score: 5.3 Sequence: TTTGTGAATTACTGATCAAA Position: -53 Score: 5.4 Sequence: TTTGTGAAGTAGTGAGCAAA Locus tag: BSU38760 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: BSU38750 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) Locus tag: BSU38740 Name: cydC Funciton: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function Locus tag: BSU38730 Name: cydD Funciton: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
	BSU38760	cydA	Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
	BSU38750	cydB	Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
	BSU38740	cydC	ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
	BSU38730	cydD	ABC membrane transporter (ATP-binding protein) required for cytochrome bd function

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD