Regulon of Rex in Bacillus pumilus SAFR-032

Properties
Regulator type:	Transcription factor
TF locus tag:	BPUM_0528
Regulator family:	Rex
Regulation mode:	repressor
Biological process:	Energy metabolism
Effector:	NADH
Regulog:	Rex - Bacillales
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 64 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - Rex
By TF family - Rex
By effector - NADH
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 5.5 Sequence: TATGTGAAACAATTCACATA Locus tag: BPUM_1837 Name: yndG Funciton: Hypothetical protein Locus tag: BPUM_1836 Name: yndH Funciton: Hypothetical protein Locus tag: BPUM_1835 Name: yndJ Funciton: Putative integral inner membrane protein
	BPUM_1837	yndG	Hypothetical protein
	BPUM_1836	yndH	Hypothetical protein
	BPUM_1835	yndJ	Putative integral inner membrane protein
Position: -79 Score: 6.3 Sequence: TTTGTGAAGTATTGCACAAT Position: -56 Score: 5.7 Sequence: AATGTGAAATACTTCACATA Locus tag: BPUM_0277 Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.1.27) Locus tag: BPUM_0278 Name: lctP Funciton: L-lactate permease
	BPUM_0277	ldh	L-lactate dehydrogenase (EC 1.1.1.27)
	BPUM_0278	lctP	L-lactate permease
Position: -98 Score: 5.6 Sequence: TTTGTGAACCATTGAACAAA Position: -68 Score: 4.8 Sequence: TTTGTGAAGTGGTGAGCATA Locus tag: BPUM_3519 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: BPUM_3518 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) Locus tag: BPUM_3517 Name: cydC Funciton: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function Locus tag: BPUM_3516 Name: cydD Funciton: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
	BPUM_3519	cydA	Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
	BPUM_3518	cydB	Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
	BPUM_3517	cydC	ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
	BPUM_3516	cydD	ABC membrane transporter (ATP-binding protein) required for cytochrome bd function

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD