Regulon of Rex in Bacillus cereus ATCC 14579

Properties
Regulator type:	Transcription factor
TF locus tag:	BC0291
Regulator family:	Rex
Regulation mode:	repressor
Biological process:	Energy metabolism
Effector:	NADH
Regulog:	Rex - Bacillales
Statistics of regulated genes:
- Genes	9
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 64 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - Rex
By TF family - Rex
By effector - NADH
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 5 Sequence: TTTGTGAAAAATGTAGCAAA Locus tag: BC1749 Name: yndG Funciton: Hypothetical protein Locus tag: BC1750 Name: yndH Funciton: Hypothetical protein Locus tag: BC1751 Name: yndJ Funciton: Putative integral inner membrane protein
	BC1749	yndG	Hypothetical protein
	BC1750	yndH	Hypothetical protein
	BC1751	yndJ	Putative integral inner membrane protein
Position: -82 Score: 4.8 Sequence: TTTGTGAAACTTTGTATAAA Locus tag: BC5060 Name: yjlC Funciton: Hypothetical protein Locus tag: BC5061 Name: ndh Funciton: NADH dehydrogenase (EC 1.6.99.3)
	BC5060	yjlC	Hypothetical protein
	BC5061	ndh	NADH dehydrogenase (EC 1.6.99.3)
Position: -129 Score: 5.5 Sequence: TTTGCTCAACATTTCACAAA Locus tag: BC0491 Name: pflB Funciton: Pyruvate formate-lyase (EC 2.3.1.54) Locus tag: BC0492 Name: pflA Funciton: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
	BC0491	pflB	Pyruvate formate-lyase (EC 2.3.1.54)
	BC0492	pflA	Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
Position: -163 Score: 5.8 Sequence: ATTGTTCATAATTTCACAAA Locus tag: BC2220 Name: adhB Funciton: Alcohol dehydrogenase (EC 1.1.1.1), Zn-dependent
	BC2220	adhB	Alcohol dehydrogenase (EC 1.1.1.1), Zn-dependent
Position: -103 Score: 6.1 Sequence: TTTGTGAAACATTGCACAAA Locus tag: BC1308 Name: null Funciton: Formate/nitrite family of transporters
	BC1308		Formate/nitrite family of transporters

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD