Regulog NiaR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | NiaR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Niacin |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - NiaR
- By taxonomy - Bacillales
- By TF family - NiaR
- By effector - Niacin
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 6 | 3 |
| Bacillus amyloliquefaciens FZB42 | 6 | 3 |
| Bacillus pumilus SAFR-032 | 3 | 1 |
| Bacillus licheniformis DSM 13 | 6 | 3 |
| Anoxybacillus flavithermus WK1 | 5 | 2 |
| Geobacillus kaustophilus HTA426 | 6 | 3 |
| Bacillus cereus ATCC 14579 | 6 | 3 |
| Bacillus halodurans C-125 | 6 | 3 |
| Bacillus clausii KSM-K16 | 6 | 3 |
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| niaP |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -63 score = 4.99963 sequence = ACAATGTGTAAAGACAGGTGTA Gene: BSU02950: Niacin transporter NiaP |
*
Bacillus amyloliquefaciens FZB42 Site: position = -61 score = 4.99963 sequence = ACAATGTGTAAAGACAGGTGTA Gene: RBAM_003210: Niacin transporter NiaP |
|
*
Bacillus licheniformis DSM 13 Site: position = -71 score = 5.35092 sequence = CAAAAGTGTAAAGACAGGTGTA Gene: BLi00841: Niacin transporter NiaP |
|
*
Geobacillus kaustophilus HTA426 Site: position = -39 score = 5.22887 sequence = TAAATATGTCTTTACATTGATA Gene: GK3433: Niacin transporter NiaP |
*
Bacillus cereus ATCC 14579 Site: position = -37 score = 4.74066 sequence = ATGATGTGTAAAGACACCTGTG Gene: BC5418: Niacin transporter NiaP |
|
|
|
Gene: Pjdr2_2738: Niacin transporter NiaP |
Niacin transporter NiaP |
| CRON 2. | ||||||||||||
| nifS |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -83 score = 6.48385 sequence = TACACCTGTCTTGACACCTATA Gene: BSU27880: Cysteine desulfurase (EC 2.8.1.7) |
*
Bacillus amyloliquefaciens FZB42 Site: position = -84 score = 6.48385 sequence = TACACCTGTCTTGACACCTATA Gene: RBAM_024930: Cysteine desulfurase (EC 2.8.1.7) |
|
*
Bacillus licheniformis DSM 13 Site: position = -80 score = 6.6209 sequence = TACATGTGTCTTGACACCTATA Gene: BLi02915: Cysteine desulfurase (EC 2.8.1.7) |
*
Anoxybacillus flavithermus WK1 Site: position = -29 score = 4.38702 sequence = GACACCTATATTGACATATATT Site: position = -41 score = 5.45278 sequence = TCATACTGTCTTGACACCTATA Gene: Aflv_0702: Cysteine desulfurase (EC 2.8.1.7) |
*
Geobacillus kaustophilus HTA426 Site: position = -86 score = 6.06852 sequence = TTCACCTGTCTTGACATCTATA Gene: GK2602: Cysteine desulfurase (EC 2.8.1.7) |
*
Bacillus cereus ATCC 14579 Site: position = -127 score = 6.15591 sequence = TCCAACTGTCTTGACACCTATA Gene: BC4424: Cysteine desulfurase (EC 2.8.1.7) |
*
Bacillus halodurans C-125 Site: position = -102 score = 6.44612 sequence = TACATATGTCTTGACATCTATA Gene: BH1217: Cysteine desulfurase (EC 2.8.1.7) |
*
Bacillus clausii KSM-K16 Site: position = -73 score = 6.05862 sequence = TACAGTTGTCTTGTCACCTATA Gene: ABC1546: Cysteine desulfurase (EC 2.8.1.7) |
|
|
Cysteine desulfurase (EC 2.8.1.7) |
| niaR |
Gene: BSU27890: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: RBAM_024940: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: BPUM_2429: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: BLi02916: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: Aflv_0701: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: GK2603: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: BC4425: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: BH1216: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: ABC1545: NAD biosynthesis transcription regulator, HTH_11 family |
|
|
NAD biosynthesis transcription regulator, HTH_11 family |
| CRON 3. | ||||||||||||
| nadB |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -41 score = 6.48385 sequence = TATAGGTGTCAAGACAGGTGTA Gene: BSU27870: L-aspartate oxidase (EC 1.4.3.16) |
*
Bacillus amyloliquefaciens FZB42 Site: position = -43 score = 6.48385 sequence = TATAGGTGTCAAGACAGGTGTA Gene: RBAM_024920: L-aspartate oxidase (EC 1.4.3.16) |
*
Bacillus pumilus SAFR-032 Site: position = -38 score = 5.90135 sequence = GATATGTGTCAAGACAGGTGTA Gene: BPUM_2427: L-aspartate oxidase (EC 1.4.3.16) |
*
Bacillus licheniformis DSM 13 Site: position = -42 score = 6.6209 sequence = TATAGGTGTCAAGACACATGTA Gene: BLi02914: L-aspartate oxidase (EC 1.4.3.16) |
*
Anoxybacillus flavithermus WK1 Site: position = -37 score = 5.45278 sequence = TATAGGTGTCAAGACAGTATGA Site: position = -49 score = 4.38702 sequence = AATATATGTCAATATAGGTGTC Gene: Aflv_0703: L-aspartate oxidase (EC 1.4.3.16) |
*
Geobacillus kaustophilus HTA426 Site: position = -41 score = 6.06852 sequence = TATAGATGTCAAGACAGGTGAA Gene: GK2601: L-aspartate oxidase (EC 1.4.3.16) |
*
Bacillus cereus ATCC 14579 Site: position = -47 score = 6.15591 sequence = TATAGGTGTCAAGACAGTTGGA Gene: BC4423: L-aspartate oxidase (EC 1.4.3.16) |
*
Bacillus halodurans C-125 Site: position = -39 score = 6.44612 sequence = TATAGATGTCAAGACATATGTA Gene: BH1218: L-aspartate oxidase (EC 1.4.3.16) |
*
Bacillus clausii KSM-K16 Site: position = -36 score = 6.05862 sequence = TATAGGTGACAAGACAACTGTA Gene: ABC1547: L-aspartate oxidase (EC 1.4.3.16) |
|
Gene: Pjdr2_0069: L-aspartate oxidase (EC 1.4.3.16) |
L-aspartate oxidase (EC 1.4.3.16) |
| nadC |
Gene: BSU27860: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) |
Gene: RBAM_024910: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) |
Gene: BPUM_2426: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) |
Gene: BLi02913: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) |
Gene: Aflv_0704: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) |
Gene: GK2600: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) |
Gene: BC4422: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) |
Gene: BH1219: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) |
Gene: ABC1548: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) |
|
Gene: Pjdr2_0070: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) |
Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) |
| nadA |
Gene: BSU27850: Quinolinate synthetase (EC 4.1.99.-) |
Gene: RBAM_024900: Quinolinate synthetase (EC 4.1.99.-) |
Gene: BPUM_2425: Quinolinate synthetase (EC 4.1.99.-) |
Gene: BLi02912: Quinolinate synthetase (EC 4.1.99.-) |
Gene: Aflv_0705: Quinolinate synthetase (EC 4.1.99.-) |
Gene: GK2599: Quinolinate synthetase (EC 4.1.99.-) |
Gene: BC4421: Quinolinate synthetase (EC 4.1.99.-) |
Gene: BH1220: Quinolinate synthetase (EC 4.1.99.-) |
Gene: ABC1549: Quinolinate synthetase (EC 4.1.99.-) |
|
Gene: Pjdr2_0068: Quinolinate synthetase (EC 4.1.99.-) |
Quinolinate synthetase (EC 4.1.99.-) |
| CRON 4. | ||||||||||||
| niaY |
|
|
Gene: BPUM_2631: Predicted nicotinate-regulated transporter NiaY |
|
|
|
|
*
Bacillus halodurans C-125 Site: position = -85 score = 5.27121 sequence = GAAATGTGTCTTGTCATGTGTA Gene: BH3254: Predicted nicotinate-regulated transporter NiaY |
*
Bacillus clausii KSM-K16 Site: position = -76 score = 5.03066 sequence = AAAAAGTGTCTTGTCACATGAA Gene: ABC2773: Predicted nicotinate-regulated transporter NiaY |
|
|
Predicted nicotinate-regulated transporter NiaY |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |