Regulon of NiaR in Bacillus pumilus SAFR-032

Properties
Regulator type:	Transcription factor
TF locus tag:	BPUM_2429
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By trascription factor - NiaR
By taxonomy - Bacillales
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 5.9 Sequence: GATATGTGTCAAGACAGGTGTA Locus tag: BPUM_2427 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: BPUM_2426 Name: nadC Funciton: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) Locus tag: BPUM_2425 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
	BPUM_2427	nadB	L-aspartate oxidase (EC 1.4.3.16)
	BPUM_2426	nadC	Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19)
	BPUM_2425	nadA	Quinolinate synthetase (EC 4.1.99.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD