Regulon of NiaR in Geobacillus kaustophilus HTA426

Properties
Regulator type:	Transcription factor
TF locus tag:	GK2603
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By trascription factor - NiaR
By taxonomy - Bacillales
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 5.2 Sequence: TAAATATGTCTTTACATTGATA Locus tag: GK3433 Name: niaP Funciton: Niacin transporter NiaP
	GK3433	niaP	Niacin transporter NiaP
Position: -86 Score: 6.1 Sequence: TTCACCTGTCTTGACATCTATA Locus tag: GK2602 Name: nifS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: GK2603 Name: niaR Funciton: NAD biosynthesis transcription regulator, HTH_11 family
	GK2602	nifS	Cysteine desulfurase (EC 2.8.1.7)
	GK2603	niaR	NAD biosynthesis transcription regulator, HTH_11 family
Position: -41 Score: 6.1 Sequence: TATAGATGTCAAGACAGGTGAA Locus tag: GK2601 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: GK2600 Name: nadC Funciton: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) Locus tag: GK2599 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
	GK2601	nadB	L-aspartate oxidase (EC 1.4.3.16)
	GK2600	nadC	Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19)
	GK2599	nadA	Quinolinate synthetase (EC 4.1.99.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD