Regulon of NiaR in Bacillus cereus ATCC 14579

Properties
Regulator type:	Transcription factor
TF locus tag:	BC4425
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By trascription factor - NiaR
By taxonomy - Bacillales
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 4.7 Sequence: ATGATGTGTAAAGACACCTGTG Locus tag: BC5418 Name: niaP Funciton: Niacin transporter NiaP
	BC5418	niaP	Niacin transporter NiaP
Position: -127 Score: 6.2 Sequence: TCCAACTGTCTTGACACCTATA Locus tag: BC4424 Name: nifS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: BC4425 Name: niaR Funciton: NAD biosynthesis transcription regulator, HTH_11 family
	BC4424	nifS	Cysteine desulfurase (EC 2.8.1.7)
	BC4425	niaR	NAD biosynthesis transcription regulator, HTH_11 family
Position: -47 Score: 6.2 Sequence: TATAGGTGTCAAGACAGTTGGA Locus tag: BC4423 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: BC4422 Name: nadC Funciton: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) Locus tag: BC4421 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
	BC4423	nadB	L-aspartate oxidase (EC 1.4.3.16)
	BC4422	nadC	Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19)
	BC4421	nadA	Quinolinate synthetase (EC 4.1.99.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD