Regulon of NiaR in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH1216
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By trascription factor - NiaR
By taxonomy - Bacillales
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -102 Score: 6.4 Sequence: TACATATGTCTTGACATCTATA Locus tag: BH1217 Name: nifS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: BH1216 Name: niaR Funciton: NAD biosynthesis transcription regulator, HTH_11 family
	BH1217	nifS	Cysteine desulfurase (EC 2.8.1.7)
	BH1216	niaR	NAD biosynthesis transcription regulator, HTH_11 family
Position: -39 Score: 6.4 Sequence: TATAGATGTCAAGACATATGTA Locus tag: BH1218 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: BH1219 Name: nadC Funciton: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) Locus tag: BH1220 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
	BH1218	nadB	L-aspartate oxidase (EC 1.4.3.16)
	BH1219	nadC	Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19)
	BH1220	nadA	Quinolinate synthetase (EC 4.1.99.-)
Position: -85 Score: 5.3 Sequence: GAAATGTGTCTTGTCATGTGTA Locus tag: BH3254 Name: niaY Funciton: Predicted nicotinate-regulated transporter NiaY
	BH3254	niaY	Predicted nicotinate-regulated transporter NiaY

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD