Regulon of NiaR in Anoxybacillus flavithermus WK1

Properties
Regulator type:	Transcription factor
TF locus tag:	Aflv_0701
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By trascription factor - NiaR
By taxonomy - Bacillales
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 5.5 Sequence: TCATACTGTCTTGACACCTATA Position: -29 Score: 4.4 Sequence: GACACCTATATTGACATATATT Locus tag: Aflv_0702 Name: nifS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: Aflv_0701 Name: niaR Funciton: NAD biosynthesis transcription regulator, HTH_11 family
	Aflv_0702	nifS	Cysteine desulfurase (EC 2.8.1.7)
	Aflv_0701	niaR	NAD biosynthesis transcription regulator, HTH_11 family
Position: -49 Score: 4.4 Sequence: AATATATGTCAATATAGGTGTC Position: -37 Score: 5.5 Sequence: TATAGGTGTCAAGACAGTATGA Locus tag: Aflv_0703 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: Aflv_0704 Name: nadC Funciton: Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19) Locus tag: Aflv_0705 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
	Aflv_0703	nadB	L-aspartate oxidase (EC 1.4.3.16)
	Aflv_0704	nadC	Probable nicotinate-nucleotide pyrophosphorylase [carboxylating] (EC 2.4.2.19)
	Aflv_0705	nadA	Quinolinate synthetase (EC 4.1.99.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD