Regulog TreR - Thermotogales
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose |
| Phylum: | Thermotogae |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By TF family - ROK
- By effector - Trehalose
- By pathway - Trehalose utilization
| Genome | Genes | Operons |
|---|---|---|
| Thermotoga maritima MSB8 | 2 | 1 |
| Thermotoga sp. RQ2 | 5 | 2 |
| Thermotoga neapolitana DSM 4359 | 6 | 2 |
| Thermotoga petrophila RKU-1 | 6 | 2 |
| Thermotoga naphthophila RKU-10 | 6 | 2 |
| Thermotoga lettingae TMO | 5 | 1 |
| Thermosipho africanus TCF52B | 5 | 2 |
| Thermosipho melanesiensis BI429 | 5 | 2 |
| Fervidobacterium nodosum Rt17-B1 | 5 | 2 |
| Petrotoga mobilis SJ95 | ||
| Thermotogales bacterium TBF 19.5.1 | 5 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| amyE |
|
|
*
Thermotoga neapolitana DSM 4359 Site: position = -478 score = 5.89165 sequence = tTaTtTTCATTTAACGAAaAAAa Gene: CTN_0781: extracellular alpha-amylase precursor |
*
Thermotoga petrophila RKU-1 Site: position = -143 score = 5.89165 sequence = TTATTTTCATTTAACGAAAAAAA Gene: Tpet_0953: extracellular alpha-amylase precursor |
*
Thermotoga naphthophila RKU-10 Site: position = -143 score = 5.89165 sequence = TTATTTTCATTTAACGAAAAAAA Gene: Tnap_0601: extracellular alpha-amylase precursor |
|
|
|
Gene: Fnod_1683: extracellular alpha-amylase precursor |
Gene: Pmob_1428: extracellular alpha-amylase precursor |
Gene: Kole_0461: extracellular alpha-amylase precursor |
extracellular alpha-amylase precursor |
| treE |
|
*
Thermotoga sp. RQ2 Site: position = -139 score = 5.89165 sequence = TTATTTTCATTTAACGAAAAAAA Gene: TRQ2_0970: Trehalose ABC transporter, substrate-binding component |
Gene: CTN_0780: Trehalose ABC transporter, substrate-binding component |
Gene: Tpet_0954: Trehalose ABC transporter, substrate-binding component |
Gene: Tnap_0600: Trehalose ABC transporter, substrate-binding component |
|
*
Thermosipho africanus TCF52B Site: position = -327 score = 5.93507 sequence = TTTAATTCGAATTTCGAAAAAAT Site: position = -56 score = 5.89233 sequence = ATAAATTCGAAAATCGAAAAAAT Gene: THA_844: Trehalose ABC transporter, substrate-binding component |
*
Thermosipho melanesiensis BI429 Site: position = -316 score = 5.59713 sequence = ATTTTTTTGAATTTCGAAATAAT Gene: Tmel_1820: Trehalose ABC transporter, substrate-binding component |
*
Fervidobacterium nodosum Rt17-B1 Site: position = -248 score = 5.9263 sequence = ATATATTCGAATTTCGAATATAT Gene: Fnod_0450: Trehalose ABC transporter, substrate-binding component |
Gene: Pmob_0027: Trehalose ABC transporter, substrate-binding component |
|
Trehalose ABC transporter, substrate-binding component |
| treF |
|
Gene: TRQ2_0971: Trehalose ABC transporter, permease component 1 |
Gene: CTN_0779: Trehalose ABC transporter, permease component 1 |
Gene: Tpet_0955: Trehalose ABC transporter, permease component 1 |
Gene: Tnap_0599: Trehalose ABC transporter, permease component 1 |
|
Gene: THA_845: Trehalose ABC transporter, permease component 1 |
Gene: Tmel_1819: Trehalose ABC transporter, permease component 1 |
Gene: Fnod_0449: Trehalose ABC transporter, permease component 1 |
Gene: Pmob_0028: Trehalose ABC transporter, permease component 1 |
|
Trehalose ABC transporter, permease component 1 |
| treG |
|
Gene: TRQ2_0972: Trehalose ABC transporter, permease component 2 |
Gene: CTN_0778: Trehalose ABC transporter, permease component 2 |
Gene: Tpet_0956: Trehalose ABC transporter, permease component 2 |
Gene: Tnap_0598: Trehalose ABC transporter, permease component 2 |
|
Gene: THA_846: Trehalose ABC transporter, permease component 2 |
Gene: Tmel_1818: Trehalose ABC transporter, permease component 2 |
Gene: Fnod_0448: Trehalose ABC transporter, permease component 2 |
Gene: Pmob_0029: Trehalose ABC transporter, permease component 2 |
|
Trehalose ABC transporter, permease component 2 |
| CRON 2. | ||||||||||||
| treX |
|
|
|
|
|
*
Thermotoga lettingae TMO Site: position = -8 score = 5.70249 sequence = ATTAATTCATGTTACGACAAAAT Gene: Tlet_1844: Predicted trehalose ABC transporter, substrate-binding component (Archaea-type) |
|
|
|
|
*
Thermotogales bacterium TBF 19.5.1 Site: position = -74 score = 5.62443 sequence = CTTTATTCAAGACTTGAATTTAT Gene: Kole_0303: Predicted trehalose ABC transporter, substrate-binding component (Archaea-type) |
Predicted trehalose ABC transporter, substrate-binding component (Archaea-type) |
| treY |
|
|
|
|
|
Gene: Tlet_1843: Predicted trehalose ABC transporter, permease component 1 (Archaea-type) |
|
|
|
|
Gene: Kole_0302: Predicted trehalose ABC transporter, permease component 1 (Archaea-type) |
Predicted trehalose ABC transporter, permease component 1 (Archaea-type) |
| treZ |
|
|
|
|
|
Gene: Tlet_1842: Predicted trehalose ABC transporter, permease component 2 (Archaea-type) |
|
|
|
|
Gene: Kole_0301: Predicted trehalose ABC transporter, permease component 2 (Archaea-type) |
Predicted trehalose ABC transporter, permease component 2 (Archaea-type) |
| treT |
*
Thermotoga maritima MSB8 Site: position = -38 score = 6.09365 sequence = ATTAATTCAAGTTACGAATAAAT Gene: TM0392: Trehalose synthase, nucleoside diphosphate glucose dependent |
*
Thermotoga sp. RQ2 Site: position = -38 score = 6.09365 sequence = ATTAATTCAAGTTACGAATAAAT Gene: TRQ2_0542: Trehalose synthase, nucleoside diphosphate glucose dependent |
*
Thermotoga neapolitana DSM 4359 Site: position = -37 score = 6.09365 sequence = ATTAATTCAAGTTACGAATAAAT Gene: CTN_0277: Trehalose synthase, nucleoside diphosphate glucose dependent |
*
Thermotoga petrophila RKU-1 Site: position = -38 score = 6.09365 sequence = ATTAATTCAAGTTACGAATAAAT Gene: Tpet_0528: Trehalose synthase, nucleoside diphosphate glucose dependent |
*
Thermotoga naphthophila RKU-10 Site: position = -38 score = 6.09365 sequence = ATTAATTCAAGTTACGAATAAAT Gene: Tnap_0184: Trehalose synthase, nucleoside diphosphate glucose dependent |
Gene: Tlet_1841: Trehalose synthase, nucleoside diphosphate glucose dependent |
*
Thermosipho africanus TCF52B Site: position = -35 score = 5.93507 sequence = ATTTTTTCGAAATTCGAATTAAA Gene: THA_843: Trehalose synthase, nucleoside diphosphate glucose dependent |
*
Thermosipho melanesiensis BI429 Site: position = -38 score = 5.59713 sequence = ATTATTTCGAAATTCAAAAAAAT Gene: Tmel_1821: Trehalose synthase, nucleoside diphosphate glucose dependent |
*
Fervidobacterium nodosum Rt17-B1 Site: position = -127 score = 5.9263 sequence = ATATATTCGAAATTCGAATATAT Gene: Fnod_0451: Trehalose synthase, nucleoside diphosphate glucose dependent |
|
*
Thermotogales bacterium TBF 19.5.1 Site: position = -75 score = 5.64614 sequence = ATTTATTCAATACATGAACAAAG Gene: Kole_0299: Trehalose synthase, nucleoside diphosphate glucose dependent |
Trehalose synthase, nucleoside diphosphate glucose dependent |
| treR |
Gene: TM0393: Regulator of trehalose utilization TreR, ROK family |
Gene: TRQ2_0541: Regulator of trehalose utilization TreR, ROK family |
Gene: CTN_0276: Regulator of trehalose utilization TreR, ROK family |
Gene: Tpet_0527: Regulator of trehalose utilization TreR, ROK family |
Gene: Tnap_0185: Regulator of trehalose utilization TreR, ROK family |
Gene: Tlet_1840: Regulator of trehalose utilization TreR, ROK family |
Gene: THA_842: Regulator of trehalose utilization TreR, ROK family |
Gene: Tmel_1822: Regulator of trehalose utilization TreR, ROK family |
Gene: Fnod_0452: Regulator of trehalose utilization TreR, ROK family |
|
Gene: Kole_0300: Regulator of trehalose utilization TreR, ROK family |
Regulator of trehalose utilization TreR, ROK family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |