Regulon of TreR in Thermotoga neapolitana DSM 4359

Properties
Regulator type:	Transcription factor
TF locus tag:	CTN_0276
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Regulog:	TreR - Thermotogales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Trehalose
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.1 Sequence: ATTAATTCAAGTTACGAATAAAT Locus tag: CTN_0277 Name: treT Funciton: Trehalose synthase, nucleoside diphosphate glucose dependent Locus tag: CTN_0276 Name: treR Funciton: Regulator of trehalose utilization TreR, ROK family
	CTN_0277	treT	Trehalose synthase, nucleoside diphosphate glucose dependent
	CTN_0276	treR	Regulator of trehalose utilization TreR, ROK family
Position: -478 Score: 5.9 Sequence: tTaTtTTCATTTAACGAAaAAAa Locus tag: CTN_0781 Name: amyE Funciton: extracellular alpha-amylase precursor Locus tag: CTN_0780 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: CTN_0779 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: CTN_0778 Name: treG Funciton: Trehalose ABC transporter, permease component 2
	CTN_0781	amyE	extracellular alpha-amylase precursor
	CTN_0780	treE	Trehalose ABC transporter, substrate-binding component
	CTN_0779	treF	Trehalose ABC transporter, permease component 1
	CTN_0778	treG	Trehalose ABC transporter, permease component 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD