Regulon of TreR in Thermotoga naphthophila RKU-10

Properties
Regulator type:	Transcription factor
TF locus tag:	Tnap_0185
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Regulog:	TreR - Thermotogales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Trehalose
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 6.1 Sequence: ATTAATTCAAGTTACGAATAAAT Locus tag: Tnap_0184 Name: treT Funciton: Trehalose synthase, nucleoside diphosphate glucose dependent Locus tag: Tnap_0185 Name: treR Funciton: Regulator of trehalose utilization TreR, ROK family
	Tnap_0184	treT	Trehalose synthase, nucleoside diphosphate glucose dependent
	Tnap_0185	treR	Regulator of trehalose utilization TreR, ROK family
Position: -143 Score: 5.9 Sequence: TTATTTTCATTTAACGAAAAAAA Locus tag: Tnap_0601 Name: amyE Funciton: extracellular alpha-amylase precursor Locus tag: Tnap_0600 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: Tnap_0599 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: Tnap_0598 Name: treG Funciton: Trehalose ABC transporter, permease component 2
	Tnap_0601	amyE	extracellular alpha-amylase precursor
	Tnap_0600	treE	Trehalose ABC transporter, substrate-binding component
	Tnap_0599	treF	Trehalose ABC transporter, permease component 1
	Tnap_0598	treG	Trehalose ABC transporter, permease component 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD