Regulon of TreR in Thermotoga maritima MSB8

Properties
Regulator type:	Transcription factor
TF locus tag:	TM0393
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Regulog:	TreR - Thermotogales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Trehalose
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 6.1 Sequence: ATTAATTCAAGTTACGAATAAAT Locus tag: TM0392 Name: treT Funciton: Trehalose synthase, nucleoside diphosphate glucose dependent Locus tag: TM0393 Name: treR Funciton: Regulator of trehalose utilization TreR, ROK family
	TM0392	treT	Trehalose synthase, nucleoside diphosphate glucose dependent
	TM0393	treR	Regulator of trehalose utilization TreR, ROK family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD