Regulon of TreR in Thermotoga lettingae TMO

Properties
Regulator type:	Transcription factor
TF locus tag:	Tlet_1840
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Regulog:	TreR - Thermotogales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Trehalose
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -8 Score: 5.7 Sequence: ATTAATTCATGTTACGACAAAAT Locus tag: Tlet_1844 Name: treX Funciton: Predicted trehalose ABC transporter, substrate-binding component (Archaea-type) Locus tag: Tlet_1843 Name: treY Funciton: Predicted trehalose ABC transporter, permease component 1 (Archaea-type) Locus tag: Tlet_1842 Name: treZ Funciton: Predicted trehalose ABC transporter, permease component 2 (Archaea-type) Locus tag: Tlet_1841 Name: treT Funciton: Trehalose synthase, nucleoside diphosphate glucose dependent Locus tag: Tlet_1840 Name: treR Funciton: Regulator of trehalose utilization TreR, ROK family
	Tlet_1844	treX	Predicted trehalose ABC transporter, substrate-binding component (Archaea-type)
	Tlet_1843	treY	Predicted trehalose ABC transporter, permease component 1 (Archaea-type)
	Tlet_1842	treZ	Predicted trehalose ABC transporter, permease component 2 (Archaea-type)
	Tlet_1841	treT	Trehalose synthase, nucleoside diphosphate glucose dependent
	Tlet_1840	treR	Regulator of trehalose utilization TreR, ROK family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD