Regulog ChiR - Thermotogales

Properties
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Chitobiose utilization
Effector:	Chitobiose
Phylum:	Thermotogae
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Chitobiose
By pathway - Chitobiose utilization

Statistics of regulated genes
Genome	Genes	Operons
Thermotoga maritima MSB8	7	1
Thermotoga sp. RQ2	7	1
Thermotoga neapolitana DSM 4359	8	1
Thermotoga petrophila RKU-1	7	1
Thermotoga naphthophila RKU-10	3	1
Thermotoga lettingae TMO	5	1
Thermosipho africanus TCF52B	7	1
Thermosipho melanesiensis BI429	7	1
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
chiR	* Thermotoga maritima MSB8 Site: position = -27 score = 6.85177 sequence = AAGTTGTTTGCGGCATGCAACTA Gene: TM0808: Regulator of chitobiose utilization ChiR, ROK family	* Thermotoga sp. RQ2 Site: position = -43 score = 6.85177 sequence = AAGTTGTTTGCGGCATGCAACTA Gene: TRQ2_0118: Regulator of chitobiose utilization ChiR, ROK family	* Thermotoga neapolitana DSM 4359 Site: position = -44 score = 6.82158 sequence = TAGTTGCTTGCAACACGCAACTA Gene: CTN_1770: Regulator of chitobiose utilization ChiR, ROK family	* Thermotoga petrophila RKU-1 Site: position = -43 score = 7.00517 sequence = AAGTTGTTTGCAGCATGCAACTA Gene: Tpet_0120: Regulator of chitobiose utilization ChiR, ROK family	* Thermotoga naphthophila RKU-10 Site: position = -43 score = 7.00517 sequence = AAGTTGTTTGCAGCATGCAACTA Gene: Tnap_0121: Regulator of chitobiose utilization ChiR, ROK family	* Thermotoga lettingae TMO Site: position = -39 score = 6.33147 sequence = TAGTTGCAGTATGCAAGCAACTA Gene: Tlet_0036: Regulator of chitobiose utilization ChiR, ROK family	* Thermosipho africanus TCF52B Site: position = -42 score = 6.51994 sequence = TAGTTGATTGAAACAACCAACTA Gene: THA_1058: Regulator of chitobiose utilization ChiR, ROK family	* Thermosipho melanesiensis BI429 Site: position = -38 score = 6.89973 sequence = TAGTTGATTGAAGCAATCAACTA Gene: Tmel_0688: Regulator of chitobiose utilization ChiR, ROK family	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Regulator of chitobiose utilization ChiR, ROK family
cbsA	Thermotoga maritima MSB8 Gene: TM0809: Beta-hexosaminidase (EC 3.2.1.52)	Thermotoga sp. RQ2 Gene: TRQ2_0117: Beta-hexosaminidase (EC 3.2.1.52)	2 Thermotoga neapolitana DSM 4359 Gene: CTN_1768: Beta-hexosaminidase (EC 3.2.1.52) Gene: CTN_1769: Beta-hexosaminidase (EC 3.2.1.52)	Thermotoga petrophila RKU-1 Gene: Tpet_0119: Beta-hexosaminidase (EC 3.2.1.52)	Thermotoga naphthophila RKU-10 Gene: Tnap_0120: Beta-hexosaminidase (EC 3.2.1.52)	Thermotoga lettingae TMO Gene: Tlet_0035: Beta-hexosaminidase (EC 3.2.1.52)	Thermosipho africanus TCF52B Gene: THA_1059: Beta-hexosaminidase (EC 3.2.1.52)	Thermosipho melanesiensis BI429 Gene: Tmel_0689: Beta-hexosaminidase (EC 3.2.1.52)	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Beta-hexosaminidase (EC 3.2.1.52)
chiE	Thermotoga maritima MSB8 Gene: TM0810: Predicted chitobiose ABC transport system, sugar-binding protein	Thermotoga sp. RQ2 Gene: TRQ2_0116: Predicted chitobiose ABC transport system, sugar-binding protein	Thermotoga neapolitana DSM 4359 Gene: CTN_1767: Predicted chitobiose ABC transport system, sugar-binding protein	Thermotoga petrophila RKU-1 Gene: Tpet_0118: Predicted chitobiose ABC transport system, sugar-binding protein	Thermotoga naphthophila RKU-10 Gene: Tnap_0119: Predicted chitobiose ABC transport system, sugar-binding protein	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted chitobiose ABC transport system, sugar-binding protein
chiF	Thermotoga maritima MSB8 Gene: TM0811: Predicted chitobiose ABC transport system, permease protein 1	Thermotoga sp. RQ2 Gene: TRQ2_0115: Predicted chitobiose ABC transport system, permease protein 1	Thermotoga neapolitana DSM 4359 Gene: CTN_1766: Predicted chitobiose ABC transport system, permease protein 1	Thermotoga petrophila RKU-1 Gene: Tpet_0117: Predicted chitobiose ABC transport system, permease protein 1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted chitobiose ABC transport system, permease protein 1
chiG	Thermotoga maritima MSB8 Gene: TM0812: Predicted chitobiose ABC transport system, permease protein 2	Thermotoga sp. RQ2 Gene: TRQ2_0114: Predicted chitobiose ABC transport system, permease protein 2	Thermotoga neapolitana DSM 4359 Gene: CTN_1765: Predicted chitobiose ABC transport system, permease protein 2	Thermotoga petrophila RKU-1 Gene: Tpet_0116: Predicted chitobiose ABC transport system, permease protein 2	Thermotoga naphthophila RKU-10 Gene: Tnap_0117: Predicted chitobiose ABC transport system, permease protein 2	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted chitobiose ABC transport system, permease protein 2
nagB	Thermotoga maritima MSB8 Gene: TM0813: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)	Thermotoga sp. RQ2 Gene: TRQ2_0113: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)	Thermotoga neapolitana DSM 4359 Gene: CTN_1764: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)	Thermotoga petrophila RKU-1 Gene: Tpet_0115: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)	Thermotoga naphthophila RKU-10 Gene: Tnap_0116: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)	Thermotoga lettingae TMO Gene: Tlet_1552: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)	Thermosipho africanus TCF52B Gene: THA_1063: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)	Thermosipho melanesiensis BI429 Gene: Tmel_0693: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95 Gene: Pmob_1553: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)	Thermotogales bacterium TBF 19.5.1 Gene: Kole_0736: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)	Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
nagA	Thermotoga maritima MSB8 Gene: TM0814: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Thermotoga sp. RQ2 Gene: TRQ2_0112: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Thermotoga neapolitana DSM 4359 Gene: CTN_1763: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Thermotoga petrophila RKU-1 Gene: Tpet_0114: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Thermotoga naphthophila RKU-10 Gene: Tnap_0115: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Thermotoga lettingae TMO Gene: Tlet_1990: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Thermosipho africanus TCF52B Gene: THA_1064: N-acetylglucosamine-6-phosphate deacetylase	Thermosipho melanesiensis BI429 Gene: Tmel_0694: N-acetylglucosamine-6-phosphate deacetylase	Fervidobacterium nodosum Rt17-B1 Gene: Fnod_0810: N-acetylglucosamine-6-phosphate deacetylase	Petrotoga mobilis SJ95 Gene: Pmob_1552: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Thermotogales bacterium TBF 19.5.1 Gene: Kole_0731: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
chiX	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO Gene: Tlet_0034: Predicted chitobiose ABC transport system II, sugar-binding protein	Thermosipho africanus TCF52B Gene: THA_1060: Predicted chitobiose ABC transport system II, sugar-binding protein	Thermosipho melanesiensis BI429 Gene: Tmel_0690: Predicted chitobiose ABC transport system II, sugar-binding protein	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted chitobiose ABC transport system II, sugar-binding protein
chiY	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO Gene: Tlet_0033: Predicted chitobiose ABC transport system II, permease protein 1	Thermosipho africanus TCF52B Gene: THA_1061: Predicted chitobiose ABC transport system II, permease protein 1	Thermosipho melanesiensis BI429 Gene: Tmel_0691: Predicted chitobiose ABC transport system II, permease protein 1	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted chitobiose ABC transport system II, permease protein 1
chiZ	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO Gene: Tlet_0032: Predicted chitobiose ABC transport system, permease protein 2	Thermosipho africanus TCF52B Gene: THA_1062: Predicted chitobiose ABC transport system, permease protein 2	Thermosipho melanesiensis BI429 Gene: Tmel_0692: Predicted chitobiose ABC transport system, permease protein 2	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted chitobiose ABC transport system, permease protein 2

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog ChiR - Thermotogales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --