Regulon of ChiR in Thermosipho melanesiensis BI429

Properties
Regulator type:	Transcription factor
TF locus tag:	Tmel_0688
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Chitobiose utilization
Effector:	Chitobiose
Regulog:	ChiR - Thermotogales
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Chitobiose
By pathway - Chitobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 6.9 Sequence: TAGTTGATTGAAGCAATCAACTA Locus tag: Tmel_0688 Name: chiR Funciton: Regulator of chitobiose utilization ChiR, ROK family Locus tag: Tmel_0689 Name: cbsA Funciton: Beta-hexosaminidase (EC 3.2.1.52) Locus tag: Tmel_0690 Name: chiX Funciton: Predicted chitobiose ABC transport system II, sugar-binding protein Locus tag: Tmel_0691 Name: chiY Funciton: Predicted chitobiose ABC transport system II, permease protein 1 Locus tag: Tmel_0692 Name: chiZ Funciton: Predicted chitobiose ABC transport system, permease protein 2 Locus tag: Tmel_0693 Name: nagB Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6) Locus tag: Tmel_0694 Name: null Funciton: N-acetylglucosamine-6-phosphate deacetylase
	Tmel_0688	chiR	Regulator of chitobiose utilization ChiR, ROK family
	Tmel_0689	cbsA	Beta-hexosaminidase (EC 3.2.1.52)
	Tmel_0690	chiX	Predicted chitobiose ABC transport system II, sugar-binding protein
	Tmel_0691	chiY	Predicted chitobiose ABC transport system II, permease protein 1
	Tmel_0692	chiZ	Predicted chitobiose ABC transport system, permease protein 2
	Tmel_0693	nagB	Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
	Tmel_0694		N-acetylglucosamine-6-phosphate deacetylase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD