Regulon of ChiR in Thermotoga naphthophila RKU-10

Properties
Regulator type:	Transcription factor
TF locus tag:	Tnap_0121
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Chitobiose utilization
Effector:	Chitobiose
Regulog:	ChiR - Thermotogales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Chitobiose
By pathway - Chitobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 7 Sequence: AAGTTGTTTGCAGCATGCAACTA Locus tag: Tnap_0121 Name: chiR Funciton: Regulator of chitobiose utilization ChiR, ROK family Locus tag: Tnap_0120 Name: cbsA Funciton: Beta-hexosaminidase (EC 3.2.1.52) Locus tag: Tnap_0119 Name: chiE Funciton: Predicted chitobiose ABC transport system, sugar-binding protein
	Tnap_0121	chiR	Regulator of chitobiose utilization ChiR, ROK family
	Tnap_0120	cbsA	Beta-hexosaminidase (EC 3.2.1.52)
	Tnap_0119	chiE	Predicted chitobiose ABC transport system, sugar-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD