Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing nagA gene

Properties
Regulog: ChiR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Chitobiose utilization
Effector: Chitobiose
Phylum: Thermotogae
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermosipho africanus TCF52B
Position: -42
Score: 6.51994
Sequence: TAGTTGATTGAAACAACCAACTA
Locus tag: THA_1058
Name: chiR
Funciton: Regulator of chitobiose utilization ChiR, ROK family
Locus tag: THA_1059
Name: cbsA
Funciton: Beta-hexosaminidase (EC 3.2.1.52)
Locus tag: THA_1060
Name: chiX
Funciton: Predicted chitobiose ABC transport system II, sugar-binding protein
Locus tag: THA_1061
Name: chiY
Funciton: Predicted chitobiose ABC transport system II, permease protein 1
Locus tag: THA_1062
Name: chiZ
Funciton: Predicted chitobiose ABC transport system, permease protein 2
Locus tag: THA_1063
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
Locus tag: THA_1064
Name: null
Funciton: N-acetylglucosamine-6-phosphate deacetylase
chiR-cbsA-chiX-chiY-chiZ-nagB-THA_1064 -42 6.5 TAGTTGATTGAAACAACCAACTA THA_1058
Thermosipho melanesiensis BI429
Position: -38
Score: 6.89973
Sequence: TAGTTGATTGAAGCAATCAACTA
Locus tag: Tmel_0688
Name: chiR
Funciton: Regulator of chitobiose utilization ChiR, ROK family
Locus tag: Tmel_0689
Name: cbsA
Funciton: Beta-hexosaminidase (EC 3.2.1.52)
Locus tag: Tmel_0690
Name: chiX
Funciton: Predicted chitobiose ABC transport system II, sugar-binding protein
Locus tag: Tmel_0691
Name: chiY
Funciton: Predicted chitobiose ABC transport system II, permease protein 1
Locus tag: Tmel_0692
Name: chiZ
Funciton: Predicted chitobiose ABC transport system, permease protein 2
Locus tag: Tmel_0693
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
Locus tag: Tmel_0694
Name: null
Funciton: N-acetylglucosamine-6-phosphate deacetylase
chiR-cbsA-chiX-chiY-chiZ-nagB-Tmel_0694 -38 6.9 TAGTTGATTGAAGCAATCAACTA Tmel_0688
Thermotoga maritima MSB8
Position: -27
Score: 6.85177
Sequence: AAGTTGTTTGCGGCATGCAACTA
Locus tag: TM0808
Name: chiR
Funciton: Regulator of chitobiose utilization ChiR, ROK family
Locus tag: TM0809
Name: cbsA
Funciton: Beta-hexosaminidase (EC 3.2.1.52)
Locus tag: TM0810
Name: chiE
Funciton: Predicted chitobiose ABC transport system, sugar-binding protein
Locus tag: TM0811
Name: chiF
Funciton: Predicted chitobiose ABC transport system, permease protein 1
Locus tag: TM0812
Name: chiG
Funciton: Predicted chitobiose ABC transport system, permease protein 2
Locus tag: TM0813
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
Locus tag: TM0814
Name: nagA
Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
chiR-cbsA-chiE-chiF-chiG-nagB-nagA -27 6.9 AAGTTGTTTGCGGCATGCAACTA TM0808
Thermotoga neapolitana DSM 4359
Position: -44
Score: 6.82158
Sequence: TAGTTGCTTGCAACACGCAACTA
Locus tag: CTN_1770
Name: chiR
Funciton: Regulator of chitobiose utilization ChiR, ROK family
Locus tag: CTN_1769
Name: cbsA
Funciton: Beta-hexosaminidase (EC 3.2.1.52)
Locus tag: CTN_1768
Name: cbsA
Funciton: Beta-hexosaminidase (EC 3.2.1.52)
Locus tag: CTN_1767
Name: chiE
Funciton: Predicted chitobiose ABC transport system, sugar-binding protein
Locus tag: CTN_1766
Name: chiF
Funciton: Predicted chitobiose ABC transport system, permease protein 1
Locus tag: CTN_1765
Name: chiG
Funciton: Predicted chitobiose ABC transport system, permease protein 2
Locus tag: CTN_1764
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
Locus tag: CTN_1763
Name: nagA
Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
chiR-cbsA-cbsA-chiE-chiF-chiG-nagB-nagA -44 6.8 TAGTTGCTTGCAACACGCAACTA CTN_1770
Thermotoga petrophila RKU-1
Position: -43
Score: 7.00517
Sequence: AAGTTGTTTGCAGCATGCAACTA
Locus tag: Tpet_0120
Name: chiR
Funciton: Regulator of chitobiose utilization ChiR, ROK family
Locus tag: Tpet_0119
Name: cbsA
Funciton: Beta-hexosaminidase (EC 3.2.1.52)
Locus tag: Tpet_0118
Name: chiE
Funciton: Predicted chitobiose ABC transport system, sugar-binding protein
Locus tag: Tpet_0117
Name: chiF
Funciton: Predicted chitobiose ABC transport system, permease protein 1
Locus tag: Tpet_0116
Name: chiG
Funciton: Predicted chitobiose ABC transport system, permease protein 2
Locus tag: Tpet_0115
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
Locus tag: Tpet_0114
Name: nagA
Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
chiR-cbsA-chiE-chiF-chiG-nagB-nagA -43 7 AAGTTGTTTGCAGCATGCAACTA Tpet_0120
Thermotoga sp. RQ2
Position: -43
Score: 6.85177
Sequence: AAGTTGTTTGCGGCATGCAACTA
Locus tag: TRQ2_0118
Name: chiR
Funciton: Regulator of chitobiose utilization ChiR, ROK family
Locus tag: TRQ2_0117
Name: cbsA
Funciton: Beta-hexosaminidase (EC 3.2.1.52)
Locus tag: TRQ2_0116
Name: chiE
Funciton: Predicted chitobiose ABC transport system, sugar-binding protein
Locus tag: TRQ2_0115
Name: chiF
Funciton: Predicted chitobiose ABC transport system, permease protein 1
Locus tag: TRQ2_0114
Name: chiG
Funciton: Predicted chitobiose ABC transport system, permease protein 2
Locus tag: TRQ2_0113
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
Locus tag: TRQ2_0112
Name: nagA
Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
chiR-cbsA-chiE-chiF-chiG-nagB-nagA -43 6.9 AAGTTGTTTGCGGCATGCAACTA TRQ2_0118