Regulon of ChiR in Thermotoga lettingae TMO

Properties
Regulator type:	Transcription factor
TF locus tag:	Tlet_0036
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Chitobiose utilization
Effector:	Chitobiose
Regulog:	ChiR - Thermotogales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Chitobiose
By pathway - Chitobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 6.3 Sequence: TAGTTGCAGTATGCAAGCAACTA Locus tag: Tlet_0036 Name: chiR Funciton: Regulator of chitobiose utilization ChiR, ROK family Locus tag: Tlet_0035 Name: cbsA Funciton: Beta-hexosaminidase (EC 3.2.1.52) Locus tag: Tlet_0034 Name: chiX Funciton: Predicted chitobiose ABC transport system II, sugar-binding protein Locus tag: Tlet_0033 Name: chiY Funciton: Predicted chitobiose ABC transport system II, permease protein 1 Locus tag: Tlet_0032 Name: chiZ Funciton: Predicted chitobiose ABC transport system, permease protein 2
	Tlet_0036	chiR	Regulator of chitobiose utilization ChiR, ROK family
	Tlet_0035	cbsA	Beta-hexosaminidase (EC 3.2.1.52)
	Tlet_0034	chiX	Predicted chitobiose ABC transport system II, sugar-binding protein
	Tlet_0033	chiY	Predicted chitobiose ABC transport system II, permease protein 1
	Tlet_0032	chiZ	Predicted chitobiose ABC transport system, permease protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD