Regulon of ChiR in Thermotoga neapolitana DSM 4359

Properties
Regulator type:	Transcription factor
TF locus tag:	CTN_1770
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Chitobiose utilization
Effector:	Chitobiose
Regulog:	ChiR - Thermotogales
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Chitobiose
By pathway - Chitobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 6.8 Sequence: TAGTTGCTTGCAACACGCAACTA Locus tag: CTN_1770 Name: chiR Funciton: Regulator of chitobiose utilization ChiR, ROK family Locus tag: CTN_1769 Name: cbsA Funciton: Beta-hexosaminidase (EC 3.2.1.52) Locus tag: CTN_1768 Name: cbsA Funciton: Beta-hexosaminidase (EC 3.2.1.52) Locus tag: CTN_1767 Name: chiE Funciton: Predicted chitobiose ABC transport system, sugar-binding protein Locus tag: CTN_1766 Name: chiF Funciton: Predicted chitobiose ABC transport system, permease protein 1 Locus tag: CTN_1765 Name: chiG Funciton: Predicted chitobiose ABC transport system, permease protein 2 Locus tag: CTN_1764 Name: nagB Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6) Locus tag: CTN_1763 Name: nagA Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
	CTN_1770	chiR	Regulator of chitobiose utilization ChiR, ROK family
	CTN_1769	cbsA	Beta-hexosaminidase (EC 3.2.1.52)
	CTN_1768	cbsA	Beta-hexosaminidase (EC 3.2.1.52)
	CTN_1767	chiE	Predicted chitobiose ABC transport system, sugar-binding protein
	CTN_1766	chiF	Predicted chitobiose ABC transport system, permease protein 1
	CTN_1765	chiG	Predicted chitobiose ABC transport system, permease protein 2
	CTN_1764	nagB	Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
	CTN_1763	nagA	N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD