Regulog FnrN - Rhodospirillales
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator (repressor) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodospirillales
- By trascription factor - FnrN/FixK
- By TF family - CRP
- By effector - Oxygen
- By pathway - Oxidative stress response
- By pathway - Nitrogen fixation
| Genome | Genes | Operons |
|---|---|---|
| Acetobacter pasteurianus IFO 3283-01 | 3 | 2 |
| Azospirillum sp. B510 | 5 | 2 |
| Gluconacetobacter diazotrophicus PAl 5 | 3 | 2 |
| Gluconobacter oxydans 621H | 2 | 2 |
| Granulibacter bethesdensis CGDNIH1 | ||
| Magnetospirillum magneticum AMB-1 | 1 | 1 |
| Magnetospirillum magnetotacticum MS-1 | 4 | 2 |
| Rhodospirillum centenum SW | 7 | 4 |
| Rhodospirillum rubrum ATCC 11170 | 3 | 2 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| ompW |
*
Acetobacter pasteurianus IFO 3283-01 Site: position = -90 score = 6.00186 sequence = GATTTGATCTAAATCAAGGC Gene: APA01_25640: Outer membrane protein W precursor |
Gene: AZL_c00520: Outer membrane protein W precursor |
*
Gluconacetobacter diazotrophicus PAl 5 Site: position = -94 score = 4.83373 sequence = CGGTTGATTCATGTCAAGGC Gene: Gdia_1985: Outer membrane protein W precursor |
*
Gluconobacter oxydans 621H Site: position = -75 score = 5.41318 sequence = GACTTGATTCAGGTCAACGT Gene: GOX0973: Outer membrane protein W precursor |
|
|
|
*
Rhodospirillum centenum SW Site: position = -121 score = 5.50714 sequence = GAATTGATCCAGGTCAGGGC Gene: RC1_1607: Outer membrane protein W precursor |
|
Outer membrane protein W precursor |
| hemN |
Gene: APA01_25630: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22) |
|
Gene: Gdia_1986: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22) |
|
|
|
|
|
|
Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22) |
| CRON 2. | ||||||||||
| ccoN |
|
*
Azospirillum sp. B510 Site: position = -192 score = 5.08125 sequence = TCGTTGACGTAGATCAATGT Gene: AZL_003350: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
|
|
|
|
*
Magnetospirillum magnetotacticum MS-1 Site: position = -161 score = 4.97722 sequence = ACTTTGATATATGTCAATGG Gene: Magn03010411: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
*
Rhodospirillum centenum SW Site: position = -190 score = 4.90273 sequence = GCATTGACATTCGTCAAAAC Site: position = -120 score = 5.43259 sequence = CCGTTGATTCAAATCAATGC Gene: RC1_1280: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
*
Rhodospirillum rubrum ATCC 11170 Site: position = -324 score = 5.69943 sequence = GATTTGATCTAAATCAATGG Gene: Rru_A3332: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
| ccoO |
|
Gene: AZL_003360: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
|
|
|
Gene: amb4363: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
Gene: Magn03010410: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
Gene: RC1_1279: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
Gene: Rru_A3331: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
| ccoQ |
|
Gene: AZL_003370: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
|
|
|
Gene: amb4364: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
|
Gene: RC1_1278: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
|
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
| ccoP |
|
Gene: AZL_003380: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
|
|
|
Gene: amb4365: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
Gene: Magn03010409: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
Gene: RC1_1277: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
Gene: Rru_A3330: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
| CRON 3. | ||||||||||
| cycA |
|
|
|
|
|
*
Magnetospirillum magneticum AMB-1 Site: position = -78 score = 5.88746 sequence = GACTTGACCTTGCTCAATGC Gene: amb0883: Cytochrome c4 precursor |
*
Magnetospirillum magnetotacticum MS-1 Site: position = -77 score = 5.88746 sequence = GACTTGACCTTGCTCAATGC Gene: Magn03010752: Cytochrome c4 precursor |
|
|
Cytochrome c4 precursor |
| CRON 4. | ||||||||||
| hemA |
|
*
Azospirillum sp. B510 Site: position = -138 score = 5.50372 sequence = GGCTTGATTTCGATCAATGC Gene: AZL_003210: 5-aminolevulinate synthase (EC 2.3.1.37) |
|
|
|
Gene: amb1683: 5-aminolevulinate synthase (EC 2.3.1.37) |
Gene: Magn03010319: 5-aminolevulinate synthase (EC 2.3.1.37) |
*
Rhodospirillum centenum SW Site: position = -164 score = 5.44628 sequence = GAATTGACCGACATCAACGC Gene: RC1_0996: 5-aminolevulinate synthase (EC 2.3.1.37) |
Gene: Rru_A2508: 5-aminolevulinate synthase (EC 2.3.1.37) |
5-aminolevulinate synthase (EC 2.3.1.37) |
| CRON 5. | ||||||||||
| fnrN |
*
Acetobacter pasteurianus IFO 3283-01 Site: position = -207 score = 6.00186 sequence = GCCTTGATTTAGATCAAATC Gene: APA01_25650: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
Gene: AZL_003420: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
*
Gluconacetobacter diazotrophicus PAl 5 Site: position = -126 score = 5.98814 sequence = GCATTGATTCAGATCAATTC Gene: Gdia_1984: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
*
Gluconobacter oxydans 621H Site: position = -90 score = 5.41318 sequence = ACGTTGACCTGAATCAAGTC Gene: GOX0974: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
|
Gene: amb4369: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
Gene: Magn03010404: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
*
Rhodospirillum centenum SW Site: position = -305 score = 5.17043 sequence = ACCTTGACTTGGATCAAGAC Gene: RC1_2984: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
*
Rhodospirillum rubrum ATCC 11170 Site: position = -119 score = 4.62425 sequence = GGTTTGACCTGGATCAAAAT Gene: Rru_A3322: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |