Regulon of FnrN in Rhodospirillum centenum SW

Properties
Regulator type:	Transcription factor
TF locus tag:	RC1_2984
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN - Rhodospirillales
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 5.5 Sequence: GAATTGATCCAGGTCAGGGC Locus tag: RC1_1607 Name: ompW Funciton: Outer membrane protein W precursor
	RC1_1607	ompW	Outer membrane protein W precursor
Position: -305 Score: 5.2 Sequence: ACCTTGACTTGGATCAAGAC Locus tag: RC1_2984 Name: fnrN Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
	RC1_2984	fnrN	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Position: -164 Score: 5.4 Sequence: GAATTGACCGACATCAACGC Locus tag: RC1_0996 Name: hemA Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
	RC1_0996	hemA	5-aminolevulinate synthase (EC 2.3.1.37)
Position: -190 Score: 4.9 Sequence: GCATTGACATTCGTCAAAAC Position: -120 Score: 5.4 Sequence: CCGTTGATTCAAATCAATGC Locus tag: RC1_1280 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: RC1_1279 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: RC1_1278 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: RC1_1277 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	RC1_1280	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	RC1_1279	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	RC1_1278	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	RC1_1277	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD