Regulon of FnrN in Rhodospirillum rubrum ATCC 11170

Properties
Regulator type:	Transcription factor
TF locus tag:	Rru_A3322
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN - Rhodospirillales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -119 Score: 4.6 Sequence: GGTTTGACCTGGATCAAAAT Locus tag: Rru_A3322 Name: fnrN Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
	Rru_A3322	fnrN	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Position: -324 Score: 5.7 Sequence: GATTTGATCTAAATCAATGG Locus tag: Rru_A3332 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Rru_A3331 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	Rru_A3332	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	Rru_A3331	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD