Orthologous regulated operons containing cycA gene

Properties
Regulog:	FnrN - Rhodospirillales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/alpha

Built upon 18 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Magnetospirillum magneticum AMB-1
Position: -78 Score: 5.88746 Sequence: GACTTGACCTTGCTCAATGC Locus tag: amb0883 Name: cycA Funciton: Cytochrome c4 precursor
cycA	-78	5.9	GACTTGACCTTGCTCAATGC	amb0883
Magnetospirillum magnetotacticum MS-1
Position: -77 Score: 5.88746 Sequence: GACTTGACCTTGCTCAATGC Locus tag: Magn03010752 Name: cycA Funciton: Cytochrome c4 precursor
cycA	-77	5.9	GACTTGACCTTGCTCAATGC	Magn03010752

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --