Regulon of FnrN in Magnetospirillum magnetotacticum MS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Magn03010404
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN - Rhodospirillales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 5.9 Sequence: GACTTGACCTTGCTCAATGC Locus tag: Magn03010752 Name: cycA Funciton: Cytochrome c4 precursor
	Magn03010752	cycA	Cytochrome c4 precursor
Position: -161 Score: 5 Sequence: ACTTTGATATATGTCAATGG Locus tag: Magn03010411 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Magn03010410 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Magn03010409 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	Magn03010411	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	Magn03010410	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	Magn03010409	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD