Regulon of FnrN in Gluconacetobacter diazotrophicus PAl 5

Properties
Regulator type:	Transcription factor
TF locus tag:	Gdia_1984
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN - Rhodospirillales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -126 Score: 6 Sequence: GCATTGATTCAGATCAATTC Locus tag: Gdia_1984 Name: fnrN Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
	Gdia_1984	fnrN	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Position: -94 Score: 4.8 Sequence: CGGTTGATTCATGTCAAGGC Locus tag: Gdia_1985 Name: ompW Funciton: Outer membrane protein W precursor Locus tag: Gdia_1986 Name: hemN Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
	Gdia_1985	ompW	Outer membrane protein W precursor
	Gdia_1986	hemN	Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD