Regulog Zur - Nocardiaceae

Properties
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Nocardia farcinica IFM 10152	14	5
Rhodococcus erythropolis PR4	12	5
Rhodococcus opacus B4	16	6
Rhodococcus sp. RHA1	16	6

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
yciC3	Nocardia farcinica IFM 10152 Gene: nfa53180: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	* Rhodococcus erythropolis PR4 Site: position = -25 score = 5.69713 sequence = TAATGACAATGGTTACCATTA Gene: RER_14090: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	Rhodococcus opacus B4	* Rhodococcus sp. RHA1 Site: position = -25 score = 5.20476 sequence = TAATGAAAACAGTTATCATTT Gene: RHA1_ro05533: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

CRON 2.
znuB2	* Nocardia farcinica IFM 10152 Site: position = -35 score = 5.1838 sequence = TAGTGATAATCGTTTTCATCT Gene: nfa23260: Zinc ABC transporter, inner membrane permease protein ZnuB	Rhodococcus erythropolis PR4	* Rhodococcus opacus B4 Site: position = -31 score = 5.74596 sequence = TTACGACAATCATTATCGTTA Gene: ROP_22700: Zinc ABC transporter, inner membrane permease protein ZnuB	* Rhodococcus sp. RHA1 Site: position = -31 score = 5.74596 sequence = TTACGACAATCATTATCGTTA Gene: RHA1_ro02546: Zinc ABC transporter, inner membrane permease protein ZnuB	Zinc ABC transporter, inner membrane permease protein ZnuB
ROP_22710	Nocardia farcinica IFM 10152	Rhodococcus erythropolis PR4	Rhodococcus opacus B4 Gene: ROP_22710: WD40/YVTN repeat-like-containing domain	Rhodococcus sp. RHA1 Gene: RHA1_ro02547: WD40/YVTN repeat-like-containing domain	WD40/YVTN repeat-like-containing domain
znuA2	Nocardia farcinica IFM 10152 Gene: nfa23270: Zinc ABC transporter, periplasmic-binding protein ZnuA	Rhodococcus erythropolis PR4	Rhodococcus opacus B4 Gene: ROP_22720: Zinc ABC transporter, periplasmic-binding protein ZnuA	Rhodococcus sp. RHA1 Gene: RHA1_ro02548: Zinc ABC transporter, periplasmic-binding protein ZnuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
nfa23280	Nocardia farcinica IFM 10152 Gene: nfa23280: WD40/YVTN repeat-like-containing domain	* Rhodococcus erythropolis PR4 Site: position = -39 score = 4.99564 sequence = CTTTGACAATCATTTACATTA Gene: RER_54290: WD40/YVTN repeat-like-containing domain	* Rhodococcus opacus B4 Site: position = -47 score = 4.58332 sequence = CTTTGACAACCGTTTGCAAAA Gene: ROP_22730: WD40/YVTN repeat-like-containing domain	* Rhodococcus sp. RHA1 Site: position = -47 score = 4.7047 sequence = CTTTGACAACCGTTTGCAATA Gene: RHA1_ro02549: WD40/YVTN repeat-like-containing domain	WD40/YVTN repeat-like-containing domain

CRON 3.
yciC	* Nocardia farcinica IFM 10152 Site: position = -88 score = 5.69589 sequence = TGATGACAATCGTTTTCGACA Site: position = -33 score = 5.44225 sequence = AAATGACAATCGTTATCGAAA Gene: nfa49740: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	* Rhodococcus erythropolis PR4 Site: position = -84 score = 5.47748 sequence = AGATGACAATCGTTTTCGACA Site: position = -30 score = 5.05097 sequence = TAATGACAATCATTCCCAGAA Gene: RER_44020: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	* Rhodococcus opacus B4 Site: position = -56 score = 5.76118 sequence = TGATGACAATCATTTTCGACA Gene: ROP_56820: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	* Rhodococcus sp. RHA1 Site: position = -83 score = 5.76118 sequence = TGATGACAATCATTTTCGACA Site: position = -29 score = 5.66066 sequence = TAATGACAATCGTTATCGAAA Gene: RHA1_ro05618: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
rpmE2	Nocardia farcinica IFM 10152 Gene: nfa49730: LSU ribosomal protein L31p	Rhodococcus erythropolis PR4 Gene: RER_44010: LSU ribosomal protein L31p	Rhodococcus opacus B4 Gene: ROP_56830: LSU ribosomal protein L31p	Rhodococcus sp. RHA1 Gene: RHA1_ro05619: LSU ribosomal protein L31p	LSU ribosomal protein L31p
rpmF2	Nocardia farcinica IFM 10152 Gene: nfa49720: LSU ribosomal protein L32p	Rhodococcus erythropolis PR4 Gene: RER_44000: LSU ribosomal protein L32p	Rhodococcus opacus B4 Gene: ROP_04720: LSU ribosomal protein L32p	Rhodococcus sp. RHA1 Gene: RHA1_ro05620: LSU ribosomal protein L32p	LSU ribosomal protein L32p
rpmJ2	Nocardia farcinica IFM 10152	Rhodococcus erythropolis PR4	* Rhodococcus opacus B4 Site: position = -30 score = 5.81741 sequence = TAACGACAATCGTTTTCAATA Gene: ROP_04730: LSU ribosomal protein L36	Rhodococcus sp. RHA1	LSU ribosomal protein L36

CRON 4.
znuA	* Nocardia farcinica IFM 10152 Site: position = -27 score = 5.26472 sequence = TAATGGAAATCGTTTCCGTTT Gene: nfa4450: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Rhodococcus erythropolis PR4 Site: position = -56 score = 5.31931 sequence = TAACGGTAACGGTTTCCAATA Gene: RER_07030: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Rhodococcus opacus B4 Site: position = -28 score = 4.96522 sequence = CAACGGTAACGGTTTCCAATA Gene: ROP_44070: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Rhodococcus sp. RHA1 Site: position = -55 score = 4.96522 sequence = CAACGGTAACGGTTTCCAATA Gene: RHA1_ro04479: Zinc ABC transporter, periplasmic-binding protein ZnuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC	Nocardia farcinica IFM 10152 Gene: nfa4440: Zinc ABC transporter, ATP-binding protein ZnuC	Rhodococcus erythropolis PR4 Gene: RER_07020: Zinc ABC transporter, ATP-binding protein ZnuC	Rhodococcus opacus B4 Gene: ROP_44060: Zinc ABC transporter, ATP-binding protein ZnuC	Rhodococcus sp. RHA1 Gene: RHA1_ro04478: Zinc ABC transporter, ATP-binding protein ZnuC	Zinc ABC transporter, ATP-binding protein ZnuC
znuB	Nocardia farcinica IFM 10152 Gene: nfa4430: Zinc ABC transporter, inner membrane permease protein ZnuB	Rhodococcus erythropolis PR4 Gene: RER_07010: Zinc ABC transporter, inner membrane permease protein ZnuB	Rhodococcus opacus B4 Gene: ROP_44050: Zinc ABC transporter, inner membrane permease protein ZnuB	Rhodococcus sp. RHA1 Gene: RHA1_ro04477: Zinc ABC transporter, inner membrane permease protein ZnuB	Zinc ABC transporter, inner membrane permease protein ZnuB

CRON 5.
rpmB2	* Nocardia farcinica IFM 10152 Site: position = -95 score = 5.44225 sequence = TTTCGATAACGATTGTCATTT Site: position = -40 score = 5.69589 sequence = TGTCGAAAACGATTGTCATCA Gene: nfa49750: LSU ribosomal protein L28p	* Rhodococcus erythropolis PR4 Site: position = -41 score = 5.47748 sequence = TGTCGAAAACGATTGTCATCT Site: position = -95 score = 5.05097 sequence = TTCTGGGAATGATTGTCATTA Gene: RER_44030: LSU ribosomal protein L28p	* Rhodococcus opacus B4 Site: position = -116 score = 5.66066 sequence = TTTCGATAACGATTGTCATTA Site: position = -62 score = 5.76118 sequence = TGTCGAAAATGATTGTCATCA Gene: ROP_56810: LSU ribosomal protein L28p	* Rhodococcus sp. RHA1 Site: position = -117 score = 5.66066 sequence = TTTCGATAACGATTGTCATTA Site: position = -63 score = 5.76118 sequence = TGTCGAAAATGATTGTCATCA Gene: RHA1_ro05617: LSU ribosomal protein L28p	LSU ribosomal protein L28p
rpmG2	Nocardia farcinica IFM 10152 Gene: nfa49760: LSU ribosomal protein L33p	Rhodococcus erythropolis PR4 Gene: RER_44040: LSU ribosomal protein L33p	Rhodococcus opacus B4 Gene: ROP_56800: LSU ribosomal protein L33p	Rhodococcus sp. RHA1 Gene: RHA1_ro05616: LSU ribosomal protein L33p	LSU ribosomal protein L33p
rpsN2	Nocardia farcinica IFM 10152 Gene: nfa49770: SSU ribosomal protein S14p (S29e)	Rhodococcus erythropolis PR4 Gene: RER_44050: SSU ribosomal protein S14p (S29e)	Rhodococcus opacus B4 Gene: ROP_56790: SSU ribosomal protein S14p (S29e)	Rhodococcus sp. RHA1 Gene: RHA1_ro05615: SSU ribosomal protein S14p (S29e)	SSU ribosomal protein S14p (S29e)
rpsR2	Nocardia farcinica IFM 10152 Gene: nfa49780: SSU ribosomal protein S18p	Rhodococcus erythropolis PR4 Gene: RER_44060: SSU ribosomal protein S18p	Rhodococcus opacus B4 Gene: ROP_56780: SSU ribosomal protein S18p	Rhodococcus sp. RHA1 Gene: RHA1_ro05614: SSU ribosomal protein S18p	SSU ribosomal protein S18p

CRON 6.
znuC2	* Nocardia farcinica IFM 10152 Site: position = -45 score = 5.1838 sequence = AGATGAAAACGATTATCACTA Gene: nfa23250: Zinc ABC transporter, ATP-binding protein ZnuC	Rhodococcus erythropolis PR4	* Rhodococcus opacus B4 Site: position = -8 score = 5.74596 sequence = TAACGATAATGATTGTCGTAA Gene: ROP_22690: Zinc ABC transporter, ATP-binding protein ZnuC	* Rhodococcus sp. RHA1 Site: position = -8 score = 5.74596 sequence = TAACGATAATGATTGTCGTAA Gene: RHA1_ro02545: Zinc ABC transporter, ATP-binding protein ZnuC	Zinc ABC transporter, ATP-binding protein ZnuC

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Zur - Nocardiaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --