Regulog SoxR - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Superoxide stress response
Effector:	Paraquat
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155
Shewanella denitrificans OS217	3	3
Shewanella frigidimarina NCIMB 400	2	2
Shewanella amazonensis SB2B	2	2
Shewanella loihica PV-4	2	2
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3	3	2
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908	1	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
acrA	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217 Gene: Sden_1586: Probable RND efflux membrane fusion protein	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	* Shewanella piezotolerans WP3 Site: position = -69 score = 6.72362 sequence = ACCTCAAGTTAACTTGATGT Gene: swp_2308: Probable RND efflux membrane fusion protein	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Probable RND efflux membrane fusion protein
acrB	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217 Gene: Sden_1587: RND multidrug efflux transporter	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3 Gene: swp_2309: RND multidrug efflux transporter	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	RND multidrug efflux transporter

CRON 2.
PF11158	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	* Shewanella amazonensis SB2B Site: position = -62 score = 6.19153 sequence = ACCTCAAGTTGACTTGAAGT Gene: Sama_3348: Protein of unknown function DUF2938	* Shewanella loihica PV-4 Site: position = -65 score = 5.65944 sequence = ACCTCAAGTCGACTTGAAGT Gene: Shew_0422: Protein of unknown function DUF2938	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Protein of unknown function DUF2938

CRON 3.
soxR	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	* Shewanella denitrificans OS217 Site: position = -116 score = 7.25571 sequence = ACCTCAAGTTAGCTTGAGGT Gene: Sden_2125: Redox-sensitive transcriptional activator, MerR family	* Shewanella frigidimarina NCIMB 400 Site: position = -64 score = 7.00063 sequence = ACCTAAAGCTAACTTGAGGT Gene: Sfri_1565: Redox-sensitive transcriptional activator, MerR family	* Shewanella amazonensis SB2B Site: position = -32 score = 6.19153 sequence = ACTTCAAGTCAACTTGAGGT Gene: Sama_3347: Redox-sensitive transcriptional activator, MerR family	* Shewanella loihica PV-4 Site: position = -32 score = 5.65944 sequence = ACTTCAAGTCGACTTGAGGT Gene: Shew_0423: Redox-sensitive transcriptional activator, MerR family	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	* Shewanella piezotolerans WP3 Site: position = -49 score = 6.00019 sequence = ATCTCAAGTTAACTTTAGAT Gene: swp_2307: Redox-sensitive transcriptional activator, MerR family	Shewanella sediminis HAW-EB3	* Shewanella woodyi ATCC 51908 Site: position = -113 score = 4.36212 sequence = AgtTaAAGTcgACTTtAaGT Gene: Swoo_3439: Redox-sensitive transcriptional activator, MerR family	Redox-sensitive transcriptional activator, MerR family

CRON 4.
PF00903	Shewanella oneidensis MR-1 Gene: SO_3586: Glyoxalase/bleomycin resistance protein/dioxygenase	Shewanella putrefaciens CN-32 Gene: Sputcn32_1016: Glyoxalase/bleomycin resistance protein/dioxygenase	Shewanella sp W3-18-1 Gene: Sputw3181_3149: Glyoxalase/bleomycin resistance protein/dioxygenase	Shewanella sp ANA-3 Gene: Shewana3_3178: Glyoxalase/bleomycin resistance protein/dioxygenase	Shewanella sp MR-4 Gene: Shewmr4_3000: Glyoxalase/bleomycin resistance protein/dioxygenase	Shewanella sp MR-7 Gene: Shewmr7_3081: Glyoxalase/bleomycin resistance protein/dioxygenase	Shewanella baltica OS155 Gene: Sbal_1009: Glyoxalase/bleomycin resistance protein/dioxygenase	* Shewanella denitrificans OS217 Site: position = -56 score = 7.25571 sequence = ACCTCAAGCTAACTTGAGGT Gene: Sden_2124: Glyoxalase/bleomycin resistance protein/dioxygenase	* Shewanella frigidimarina NCIMB 400 Site: position = -57 score = 7.00063 sequence = ACCTCAAGTTAGCTTTAGGT Gene: Sfri_1566: Glyoxalase/bleomycin resistance protein/dioxygenase	Shewanella amazonensis SB2B Gene: Sama_2789: Glyoxalase/bleomycin resistance protein/dioxygenase	Shewanella loihica PV-4 Gene: Shew_0913: Glyoxalase/bleomycin resistance protein/dioxygenase	Shewanella pealeana ATCC 700345 Gene: Spea_0886: Glyoxalase/bleomycin resistance protein/dioxygenase	Shewanella halifaxensis HAW-EB4 Gene: Shal_0938: Glyoxalase/bleomycin resistance protein/dioxygenase	Shewanella piezotolerans WP3 Gene: swp_0890: Glyoxalase/bleomycin resistance protein/dioxygenase	Shewanella sediminis HAW-EB3 Gene: Ssed_0992: Glyoxalase/bleomycin resistance protein/dioxygenase	Shewanella woodyi ATCC 51908 Gene: Swoo_1045: Glyoxalase/bleomycin resistance protein/dioxygenase	Glyoxalase/bleomycin resistance protein/dioxygenase

CRON 5.
Sden_0647	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	* Shewanella denitrificans OS217 Site: position = -61 score = 7.00063 sequence = ACCTCAAGTTAGCTTGAGCT Gene: Sden_0647: Endoribonuclease L-PSP	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Endoribonuclease L-PSP

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SoxR - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --