Regulog SoxR - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | repressor |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | ||
| Shewanella putrefaciens CN-32 | ||
| Shewanella sp W3-18-1 | ||
| Shewanella sp ANA-3 | ||
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | 3 | 3 |
| Shewanella frigidimarina NCIMB 400 | 2 | 2 |
| Shewanella amazonensis SB2B | 2 | 2 |
| Shewanella loihica PV-4 | 2 | 2 |
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | 3 | 2 |
| Shewanella sediminis HAW-EB3 | ||
| Shewanella woodyi ATCC 51908 | 1 | 1 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| acrA |
|
|
|
|
|
|
|
Gene: Sden_1586: Probable RND efflux membrane fusion protein |
|
|
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -69 score = 6.72362 sequence = ACCTCAAGTTAACTTGATGT Gene: swp_2308: Probable RND efflux membrane fusion protein |
|
|
Probable RND efflux membrane fusion protein |
| acrB |
|
|
|
|
|
|
|
Gene: Sden_1587: RND multidrug efflux transporter |
|
|
|
|
|
Gene: swp_2309: RND multidrug efflux transporter |
|
|
RND multidrug efflux transporter |
| CRON 2. | |||||||||||||||||
| PF11158 |
|
|
|
|
|
|
|
|
|
*
Shewanella amazonensis SB2B Site: position = -62 score = 6.19153 sequence = ACCTCAAGTTGACTTGAAGT Gene: Sama_3348: Protein of unknown function DUF2938 |
*
Shewanella loihica PV-4 Site: position = -65 score = 5.65944 sequence = ACCTCAAGTCGACTTGAAGT Gene: Shew_0422: Protein of unknown function DUF2938 |
|
|
|
|
|
Protein of unknown function DUF2938 |
| CRON 3. | |||||||||||||||||
| soxR |
|
|
|
|
|
|
|
*
Shewanella denitrificans OS217 Site: position = -116 score = 7.25571 sequence = ACCTCAAGTTAGCTTGAGGT Gene: Sden_2125: Redox-sensitive transcriptional activator, MerR family |
*
Shewanella frigidimarina NCIMB 400 Site: position = -64 score = 7.00063 sequence = ACCTAAAGCTAACTTGAGGT Gene: Sfri_1565: Redox-sensitive transcriptional activator, MerR family |
*
Shewanella amazonensis SB2B Site: position = -32 score = 6.19153 sequence = ACTTCAAGTCAACTTGAGGT Gene: Sama_3347: Redox-sensitive transcriptional activator, MerR family |
*
Shewanella loihica PV-4 Site: position = -32 score = 5.65944 sequence = ACTTCAAGTCGACTTGAGGT Gene: Shew_0423: Redox-sensitive transcriptional activator, MerR family |
|
|
*
Shewanella piezotolerans WP3 Site: position = -49 score = 6.00019 sequence = ATCTCAAGTTAACTTTAGAT Gene: swp_2307: Redox-sensitive transcriptional activator, MerR family |
|
*
Shewanella woodyi ATCC 51908 Site: position = -113 score = 4.36212 sequence = AgtTaAAGTcgACTTtAaGT Gene: Swoo_3439: Redox-sensitive transcriptional activator, MerR family |
Redox-sensitive transcriptional activator, MerR family |
| CRON 4. | |||||||||||||||||
| PF00903 |
Gene: SO_3586: Glyoxalase/bleomycin resistance protein/dioxygenase |
Gene: Sputcn32_1016: Glyoxalase/bleomycin resistance protein/dioxygenase |
Gene: Sputw3181_3149: Glyoxalase/bleomycin resistance protein/dioxygenase |
Gene: Shewana3_3178: Glyoxalase/bleomycin resistance protein/dioxygenase |
Gene: Shewmr4_3000: Glyoxalase/bleomycin resistance protein/dioxygenase |
Gene: Shewmr7_3081: Glyoxalase/bleomycin resistance protein/dioxygenase |
Gene: Sbal_1009: Glyoxalase/bleomycin resistance protein/dioxygenase |
*
Shewanella denitrificans OS217 Site: position = -56 score = 7.25571 sequence = ACCTCAAGCTAACTTGAGGT Gene: Sden_2124: Glyoxalase/bleomycin resistance protein/dioxygenase |
*
Shewanella frigidimarina NCIMB 400 Site: position = -57 score = 7.00063 sequence = ACCTCAAGTTAGCTTTAGGT Gene: Sfri_1566: Glyoxalase/bleomycin resistance protein/dioxygenase |
Gene: Sama_2789: Glyoxalase/bleomycin resistance protein/dioxygenase |
Gene: Shew_0913: Glyoxalase/bleomycin resistance protein/dioxygenase |
Gene: Spea_0886: Glyoxalase/bleomycin resistance protein/dioxygenase |
Gene: Shal_0938: Glyoxalase/bleomycin resistance protein/dioxygenase |
Gene: swp_0890: Glyoxalase/bleomycin resistance protein/dioxygenase |
Gene: Ssed_0992: Glyoxalase/bleomycin resistance protein/dioxygenase |
Gene: Swoo_1045: Glyoxalase/bleomycin resistance protein/dioxygenase |
Glyoxalase/bleomycin resistance protein/dioxygenase |
| CRON 5. | |||||||||||||||||
| Sden_0647 |
|
|
|
|
|
|
|
*
Shewanella denitrificans OS217 Site: position = -61 score = 7.00063 sequence = ACCTCAAGTTAGCTTGAGCT Gene: Sden_0647: Endoribonuclease L-PSP |
|
|
|
|
|
|
|
|
Endoribonuclease L-PSP |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |