Regulon of SoxR in Shewanella piezotolerans WP3

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 6 Sequence: ATCTCAAGTTAACTTTAGAT Locus tag: swp_2307 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	swp_2307	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -69 Score: 6.7 Sequence: ACCTCAAGTTAACTTGATGT Locus tag: swp_2308 Name: acrA Funciton: Probable RND efflux membrane fusion protein Locus tag: swp_2309 Name: acrB Funciton: RND multidrug efflux transporter
	swp_2308	acrA	Probable RND efflux membrane fusion protein
	swp_2309	acrB	RND multidrug efflux transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD