Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Sden_0647 gene

Properties
Regulog: SoxR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/gamma
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella denitrificans OS217
Position: -61
Score: 7.00063
Sequence: ACCTCAAGTTAGCTTGAGCT
Locus tag: Sden_0647
Name: Sden_0647
Funciton: Endoribonuclease L-PSP
Sden_0647 -61 7 ACCTCAAGTTAGCTTGAGCT Sden_0647
© 2009-2020 RegPrecise