Regulon of SoxR in Shewanella amazonensis SB2B

Properties
Regulator type:	Transcription factor
TF locus tag:	Sama_3347
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 6.2 Sequence: ACCTCAAGTTGACTTGAAGT Locus tag: Sama_3348 Name: PF11158 Funciton: Protein of unknown function DUF2938
	Sama_3348	PF11158	Protein of unknown function DUF2938
Position: -32 Score: 6.2 Sequence: ACTTCAAGTCAACTTGAGGT Locus tag: Sama_3347 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	Sama_3347	soxR	Redox-sensitive transcriptional activator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD