Regulon of SoxR in Shewanella denitrificans OS217

Properties
Regulator type:	Transcription factor
TF locus tag:	Sden_2125
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -116 Score: 7.3 Sequence: ACCTCAAGTTAGCTTGAGGT Locus tag: Sden_2125 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	Sden_2125	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -61 Score: 7 Sequence: ACCTCAAGTTAGCTTGAGCT Locus tag: Sden_0647 Name: Sden_0647 Funciton: Endoribonuclease L-PSP
	Sden_0647	Sden_0647	Endoribonuclease L-PSP
Position: -56 Score: 7.3 Sequence: ACCTCAAGCTAACTTGAGGT Locus tag: Sden_2124 Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase
	Sden_2124	PF00903	Glyoxalase/bleomycin resistance protein/dioxygenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD