Regulog AmtR - Nocardiaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Nitrogen metabolism |
| Effector: | GlnK-AMP, signal transduction protein |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Nocardiaceae
- By trascription factor - AmtR
- By TF family - TetR
- By effector - GlnK-AMP, signal transduction protein
- By pathway - Nitrogen metabolism
| Genome | Genes | Operons |
|---|---|---|
| Nocardia farcinica IFM 10152 | 6 | 2 |
| Rhodococcus erythropolis PR4 | 5 | 2 |
| Rhodococcus opacus B4 | 5 | 2 |
| Rhodococcus sp. RHA1 | 1 | 1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| uctT |
*
Nocardia farcinica IFM 10152 Site: position = -51 score = 6.36232 sequence = CAAAACTATCAACCGACAGATATT Gene: nfa22220: Urea carboxylase-related transporter, Amino acid permease family |
*
Rhodococcus erythropolis PR4 Site: position = -58 score = 6.8596 sequence = GAAAACTATCAATCGACAGTTATT Gene: RER_29520: Urea carboxylase-related transporter, Amino acid permease family |
*
Rhodococcus opacus B4 Site: position = -47 score = 6.8596 sequence = GAAAACTATCGATCGACAGATATT Gene: ROP_68880: Urea carboxylase-related transporter, Amino acid permease family |
|
Urea carboxylase-related transporter, Amino acid permease family |
| amt1 |
Gene: nfa22210: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
Gene: RER_29530: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
Gene: ROP_68890: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
| amt2 |
Gene: nfa22200: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
Gene: RER_29540: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
Gene: ROP_68900: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
| ucaA |
Gene: nfa22190: Urea carboxylase (EC 6.3.4.6) |
Gene: RER_29550: Urea carboxylase (EC 6.3.4.6) |
2
Rhodococcus opacus B4 Gene: ROP_68910: Urea carboxylase (EC 6.3.4.6) Gene: ROP_18530: Urea carboxylase (EC 6.3.4.6) |
Gene: RHA1_ro02135: Urea carboxylase (EC 6.3.4.6) |
Urea carboxylase (EC 6.3.4.6) |
| ucaB |
Gene: nfa22180: Allophanate hydrolase (EC 3.5.1.54) |
Gene: RER_15450: Allophanate hydrolase (EC 3.5.1.54) |
Gene: ROP_18540: Allophanate hydrolase (EC 3.5.1.54) |
Gene: RHA1_ro02136: Allophanate hydrolase (EC 3.5.1.54) |
Allophanate hydrolase (EC 3.5.1.54) |
| CRON 2. | |||||
| amtR |
*
Nocardia farcinica IFM 10152 Site: position = -160 score = 6.71086 sequence = AATATCTGTCGGTTGATAGTTTTG Gene: nfa22230: Transcriptional regulator of urea utilization, TetR family |
*
Rhodococcus erythropolis PR4 Site: position = -172 score = 7.14326 sequence = AATAACTGTCGATTGATAGTTTTC Gene: RER_29510: Transcriptional regulator of urea utilization, TetR family |
*
Rhodococcus opacus B4 Site: position = -171 score = 7.23908 sequence = AATATCTGTCGATCGATAGTTTTC Gene: ROP_68870: Transcriptional regulator of urea utilization, TetR family |
*
Rhodococcus sp. RHA1 Site: position = -170 score = 7.00515 sequence = AATATCTGTCGCTCGATAGTTTTC Gene: RHA1_ro06918: Transcriptional regulator of urea utilization, TetR family |
Transcriptional regulator of urea utilization, TetR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |