Regulon of AmtR in Rhodococcus sp. RHA1

Properties
Regulator type:	Transcription factor
TF locus tag:	RHA1_ro06918
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Regulog:	AmtR - Nocardiaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By trascription factor - AmtR
By TF family - TetR
By effector - GlnK-AMP, signal transduction protein
By pathway - Nitrogen metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -170 Score: 7 Sequence: AATATCTGTCGCTCGATAGTTTTC Locus tag: RHA1_ro06918 Name: amtR Funciton: Transcriptional regulator of urea utilization, TetR family
	RHA1_ro06918	amtR	Transcriptional regulator of urea utilization, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD